EMAIL THIS PAGE TO A FRIEND

CXCL13

chemokine (C-X-C motif) ligand 13

82 Gene Product Result for
Synonyms: ANGIE ANGIE2 BCA-1 BCA1 BLC BLR1L SCYB13
UniProtKB ID: O43927
Gene ID:
Human(10563) Summary: B lymphocyte chemoattractant, independently cloned and named Angie, is a CXC chemokine strongly expressed in the follicles of the spleen, lymph nodes, and Peyer's patches. It preferentially promotes the migration of B lymphocytes (compared to T cells and macrophages), apparently by stimulating calcium influx into, and chemotaxis of, cells expressing Burkitt's lymphoma receptor 1 (BLR-1). It may therefore function in the homing of B lymphocytes to follicles. [provided by RefSeq, Jul 2008]
Mouse(55985) chemokine (C-X-C motif) ligand 13
Rat(498335) chemokine (C-X-C motif) ligand 13
domestic cat(101096888) chemokine (C-X-C motif) ligand 13
cow(511674) chemokine (C-X-C motif) ligand 13
dog(608156) chemokine (C-X-C motif) ligand 13
sheep(101111100) chemokine (C-X-C motif) ligand 13
Domestic Rabbit(100144333) chemokine (C-X-C motif) ligand 13
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006419 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006419 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006419 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018866 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018866 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018866 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042121 MISSION® esiRNA esiRNA human CXCL13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006419 Rosetta Predictions human pricing
NM_001017496 Rosetta Predictions rat pricing
NM_018866 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006419 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341532 predicted 222
2 SASI_Hs01_00076562 predicted 614
3 SASI_Hs01_00076563 predicted 878
4 SASI_Hs01_00076565 predicted 205
5 SASI_Hs01_00076566 predicted 892
6 SASI_Hs01_00076567 predicted 451
7 SASI_Hs01_00076568 predicted 659
8 SASI_Hs01_00076570 predicted 763
9 SASI_Hs01_00076571 predicted 820
10 SASI_Hs02_00341533 predicted 867
11 SASI_Hs01_00076564 predicted 421
12 SASI_Hs01_00076569 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017496 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104928 predicted 828
2 SASI_Rn01_00104929 predicted 401
3 SASI_Rn01_00104930 predicted 230
4 SASI_Rn01_00104932 predicted 455
5 SASI_Rn01_00104933 predicted 771
6 SASI_Rn01_00104934 predicted 804
7 SASI_Rn01_00104935 predicted 223
8 SASI_Rn02_00202317 predicted 530
9 SASI_Rn01_00104936 predicted 578
10 SASI_Rn01_00104937 predicted 843
11 SASI_Rn01_00104931 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018866 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079504 predicted 842
2 SASI_Mm01_00079505 predicted 839
3 SASI_Mm01_00079506 predicted 739
4 SASI_Mm01_00079507 predicted 835
5 SASI_Mm01_00079508 predicted 861
6 SASI_Mm01_00079509 predicted 662
7 SASI_Mm01_00079511 predicted 624
8 SASI_Mm02_00324243 predicted 265
9 SASI_Mm01_00079512 predicted 88
10 SASI_Mm01_00079513 predicted 125
11 SASI_Mm01_00079510 predicted 156
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006419
CXCL13 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 13
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006419.1-226s1c1
Sequence:CCGGCGCTTCATTGATCGAATTCAACTCGAGTTGAATTCGATCAATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006419.1-383s1c1
Sequence:CCGGCTCTACCAGTTCCAGTGTTTACTCGAGTAAACACTGGAACTGGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006419.1-291s1c1
Sequence:CCGGCTGGAAGAAGAACAAGTCAATCTCGAGATTGACTTGTTCTTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006419.1-347s1c1
Sequence:CCGGGAATGATGGAAGTATTGAGAACTCGAGTTCTCAATACTTCCATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006419.2-577s21c1
Sequence:CCGGTTCACTCACAGCACCCTATATCTCGAGATATAGGGTGCTGTGAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006419.2-871s21c1
Sequence:CCGGAGGAATCCATGTAGTAGATATCTCGAGATATCTACTACATGGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006419.2-399s21c1
Sequence:CCGGGATTCCCTGATGCTGATATTTCTCGAGAAATATCAGCATCAGGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006419.2-141s21c1
Sequence:CCGGAGGTGTTCTGGAGGTCTATTACTCGAGTAATAGACCTCCAGAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006419
CXCL13 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 13
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006419.1-226s1c1
Sequence:CCGGCGCTTCATTGATCGAATTCAACTCGAGTTGAATTCGATCAATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006419.1-383s1c1
Sequence:CCGGCTCTACCAGTTCCAGTGTTTACTCGAGTAAACACTGGAACTGGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006419.1-291s1c1
Sequence:CCGGCTGGAAGAAGAACAAGTCAATCTCGAGATTGACTTGTTCTTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006419.1-347s1c1
Sequence:CCGGGAATGATGGAAGTATTGAGAACTCGAGTTCTCAATACTTCCATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006419.2-577s21c1
Sequence:CCGGTTCACTCACAGCACCCTATATCTCGAGATATAGGGTGCTGTGAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006419.2-871s21c1
Sequence:CCGGAGGAATCCATGTAGTAGATATCTCGAGATATCTACTACATGGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006419.2-399s21c1
Sequence:CCGGGATTCCCTGATGCTGATATTTCTCGAGAAATATCAGCATCAGGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006419.2-141s21c1
Sequence:CCGGAGGTGTTCTGGAGGTCTATTACTCGAGTAATAGACCTCCAGAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006419
CXCL13 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 13
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006419.1-226s1c1
Sequence:CCGGCGCTTCATTGATCGAATTCAACTCGAGTTGAATTCGATCAATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006419.1-383s1c1
Sequence:CCGGCTCTACCAGTTCCAGTGTTTACTCGAGTAAACACTGGAACTGGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006419.1-291s1c1
Sequence:CCGGCTGGAAGAAGAACAAGTCAATCTCGAGATTGACTTGTTCTTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006419.1-347s1c1
Sequence:CCGGGAATGATGGAAGTATTGAGAACTCGAGTTCTCAATACTTCCATCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006419.2-577s21c1
Sequence:CCGGTTCACTCACAGCACCCTATATCTCGAGATATAGGGTGCTGTGAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006419.2-871s21c1
Sequence:CCGGAGGAATCCATGTAGTAGATATCTCGAGATATCTACTACATGGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006419.2-399s21c1
Sequence:CCGGGATTCCCTGATGCTGATATTTCTCGAGAAATATCAGCATCAGGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006419.2-141s21c1
Sequence:CCGGAGGTGTTCTGGAGGTCTATTACTCGAGTAATAGACCTCCAGAACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018866
CXCL13 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018866.1-162s1c1
Sequence:CCGGCTAAACATCATAGATCGGATTCTCGAGAATCCGATCTATGATGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018866.1-336s1c1
Sequence:CCGGCCAGTGAGTAAGAGAAGAGCTCTCGAGAGCTCTTCTCTTACTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018866.1-270s1c1
Sequence:CCGGGCCAAATGGTTACAAAGATTACTCGAGTAATCTTTGTAACCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018866.1-264s1c1
Sequence:CCGGCCTCGTGCCAAATGGTTACAACTCGAGTTGTAACCATTTGGCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018866.1-102s1c1
Sequence:CCGGGAAGCCCATTACACAAACTTACTCGAGTAAGTTTGTGTAATGGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018866
CXCL13 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018866.1-162s1c1
Sequence:CCGGCTAAACATCATAGATCGGATTCTCGAGAATCCGATCTATGATGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018866.1-336s1c1
Sequence:CCGGCCAGTGAGTAAGAGAAGAGCTCTCGAGAGCTCTTCTCTTACTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018866.1-270s1c1
Sequence:CCGGGCCAAATGGTTACAAAGATTACTCGAGTAATCTTTGTAACCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018866.1-264s1c1
Sequence:CCGGCCTCGTGCCAAATGGTTACAACTCGAGTTGTAACCATTTGGCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018866.1-102s1c1
Sequence:CCGGGAAGCCCATTACACAAACTTACTCGAGTAAGTTTGTGTAATGGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018866
CXCL13 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068279    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018866.1-162s1c1
Sequence:CCGGCTAAACATCATAGATCGGATTCTCGAGAATCCGATCTATGATGTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018866.1-336s1c1
Sequence:CCGGCCAGTGAGTAAGAGAAGAGCTCTCGAGAGCTCTTCTCTTACTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018866.1-270s1c1
Sequence:CCGGGCCAAATGGTTACAAAGATTACTCGAGTAATCTTTGTAACCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018866.1-264s1c1
Sequence:CCGGCCTCGTGCCAAATGGTTACAACTCGAGTTGTAACCATTTGGCACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018866.1-102s1c1
Sequence:CCGGGAAGCCCATTACACAAACTTACTCGAGTAAGTTTGTGTAATGGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks