EMAIL THIS PAGE TO A FRIEND

CXCL16

chemokine (C-X-C motif) ligand 16

79 Gene Product Result for
Synonyms: CXCLG16 SR-PSOX SRPSOX
Gene ID:
Mouse(66102) chemokine (C-X-C motif) ligand 16
Rat(497942) chemokine (C-X-C motif) ligand 16
sheep(101111722) chemokine (C-X-C motif) ligand 16
naked mole-rat(101722483) chemokine (C-X-C motif) ligand 16
domestic guinea pig(101787378) chemokine (C-X-C motif) ligand 16
dog(607514) chemokine (C-X-C motif) ligand 16
cow(511671) chemokine (C-X-C motif) ligand 16
domestic cat(101093310) chemokine (C-X-C motif) ligand 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022059 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022059 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022059 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023158 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023158 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023158 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100812 Rosetta Predictions human pricing
NM_022059 Rosetta Predictions human pricing
NM_001017478 Rosetta Predictions rat pricing
NM_023158 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100812 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322337 predicted 1076
2 SASI_Hs02_00322338 predicted 1047
3 SASI_Hs02_00322339 predicted 767
4 SASI_Hs02_00322340 predicted 1007
5 SASI_Hs02_00322341 predicted 771
6 SASI_Hs02_00322342 predicted 1084
7 SASI_Hs02_00322343 predicted 846
8 SASI_Hs02_00322344 predicted 734
9 SASI_Hs02_00322345 predicted 760
10 SASI_Hs02_00322346 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088038 predicted 1070
2 SASI_Hs01_00088039 predicted 1045
3 SASI_Hs01_00088040 predicted 767
4 SASI_Hs02_00355418 predicted 1012
5 SASI_Hs01_00088041 predicted 770
6 SASI_Hs01_00088042 predicted 1081
7 SASI_Hs01_00088044 predicted 844
8 SASI_Hs01_00088045 predicted 734
9 SASI_Hs01_00088046 predicted 754
10 SASI_Hs01_00088047 predicted 690
11 SASI_Hs01_00088043 predicted 743
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017478 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072748 predicted 1143
2 SASI_Rn01_00072749 predicted 435
3 SASI_Rn01_00072750 predicted 1250
4 SASI_Rn01_00072751 predicted 969
5 SASI_Rn01_00072752 predicted 772
6 SASI_Rn02_00202288 predicted 1092
7 SASI_Rn01_00072753 predicted 398
8 SASI_Rn01_00072754 predicted 1203
9 SASI_Rn01_00072755 predicted 420
10 SASI_Rn01_00072756 predicted 1129
11 SASI_Rn01_00072757 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023158 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130770 predicted 685
2 SASI_Mm02_00326880 predicted 716
3 SASI_Mm01_00130772 predicted 1405
4 SASI_Mm01_00130773 predicted 1226
5 SASI_Mm01_00130774 predicted 1540
6 SASI_Mm01_00130775 predicted 1517
7 SASI_Mm01_00130776 predicted 939
8 SASI_Mm02_00326881 predicted 718
9 SASI_Mm01_00130778 predicted 815
10 SASI_Mm01_00130779 predicted 1545
11 SASI_Mm01_00130771 predicted 724
12 SASI_Mm01_00130777 predicted 1466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022059
VALIDATED
CXCL16 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 16
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022059.2-1303s21c1
Sequence:CCGGTCCAGATCTGCCGGTTCATTACTCGAGTAATGAACCGGCAGATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022059.2-1478s21c1
Sequence:CCGGACATCCAGCCTACACGTATTTCTCGAGAAATACGTGTAGGCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022059.2-1444s21c1
Sequence:CCGGTCTGAAGGTGCGAGGATTATACTCGAGTATAATCCTCGCACCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022059.1-764s1c1
Sequence:CCGGGCTGTCTTGATCTCAAAGAATCTCGAGATTCTTTGAGATCAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_022059.1-976s1c1
Sequence:CCGGCGTCCCAATGAAACCACCATTCTCGAGAATGGTGGTTTCATTGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_022059.1-628s1c1
Sequence:CCGGCCATCGGTTCAGTTCATGAATCTCGAGATTCATGAACTGAACCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022059.1-681s1c1
Sequence:CCGGGTGTCTATACTACACGAGGTTCTCGAGAACCTCGTGTAGTATAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_022059.1-811s1c1
Sequence:CCGGGCCCACCAGAAGCATTTACTTCTCGAGAAGTAAATGCTTCTGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022059
VALIDATED
CXCL16 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 16
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022059.2-1303s21c1
Sequence:CCGGTCCAGATCTGCCGGTTCATTACTCGAGTAATGAACCGGCAGATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022059.2-1478s21c1
Sequence:CCGGACATCCAGCCTACACGTATTTCTCGAGAAATACGTGTAGGCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022059.2-1444s21c1
Sequence:CCGGTCTGAAGGTGCGAGGATTATACTCGAGTATAATCCTCGCACCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022059.1-764s1c1
Sequence:CCGGGCTGTCTTGATCTCAAAGAATCTCGAGATTCTTTGAGATCAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_022059.1-976s1c1
Sequence:CCGGCGTCCCAATGAAACCACCATTCTCGAGAATGGTGGTTTCATTGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_022059.1-628s1c1
Sequence:CCGGCCATCGGTTCAGTTCATGAATCTCGAGATTCATGAACTGAACCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022059.1-681s1c1
Sequence:CCGGGTGTCTATACTACACGAGGTTCTCGAGAACCTCGTGTAGTATAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_022059.1-811s1c1
Sequence:CCGGGCCCACCAGAAGCATTTACTTCTCGAGAAGTAAATGCTTCTGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022059
VALIDATED
CXCL16 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 16
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022059.2-1303s21c1
Sequence:CCGGTCCAGATCTGCCGGTTCATTACTCGAGTAATGAACCGGCAGATCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022059.2-1478s21c1
Sequence:CCGGACATCCAGCCTACACGTATTTCTCGAGAAATACGTGTAGGCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022059.2-1444s21c1
Sequence:CCGGTCTGAAGGTGCGAGGATTATACTCGAGTATAATCCTCGCACCTTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022059.1-764s1c1
Sequence:CCGGGCTGTCTTGATCTCAAAGAATCTCGAGATTCTTTGAGATCAAGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_022059.1-976s1c1
Sequence:CCGGCGTCCCAATGAAACCACCATTCTCGAGAATGGTGGTTTCATTGGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_022059.1-628s1c1
Sequence:CCGGCCATCGGTTCAGTTCATGAATCTCGAGATTCATGAACTGAACCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022059.1-681s1c1
Sequence:CCGGGTGTCTATACTACACGAGGTTCTCGAGAACCTCGTGTAGTATAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_022059.1-811s1c1
Sequence:CCGGGCCCACCAGAAGCATTTACTTCTCGAGAAGTAAATGCTTCTGGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023158
VALIDATED
CXCL16 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 16
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023158.6-1246s21c1
Sequence:CCGGCTCTGGTACACTCCTGTTGAACTCGAGTTCAACAGGAGTGTACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023158.6-681s21c1
Sequence:CCGGGCAGGGTACTTTGGATCACATCTCGAGATGTGATCCAAAGTACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023158.6-631s21c1
Sequence:CCGGGCTGGAAGTTGTTCTTGTGATCTCGAGATCACAAGAACAACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023158.6-1069s21c1
Sequence:CCGGGAGGCAAATGAGAAACAGCAACTCGAGTTGCTGTTTCTCATTTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023158.6-799s21c1
Sequence:CCGGCGTGAACTAGTGGACTGCTTTCTCGAGAAAGCAGTCCACTAGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023158.3-230s1c1
Sequence:CCGGGCAGGGTACTTTGGATCACATCTCGAGATGTGATCCAAAGTACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023158.3-348s1c1
Sequence:CCGGCGTGAACTAGTGGACTGCTTTCTCGAGAAAGCAGTCCACTAGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023158.3-618s1c1
Sequence:CCGGGAGGCAAATGAGAAACAGCAACTCGAGTTGCTGTTTCTCATTTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023158.3-795s1c1
Sequence:CCGGCTCTGGTACACTCCTGTTGAACTCGAGTTCAACAGGAGTGTACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023158.3-180s1c1
Sequence:CCGGGCTGGAAGTTGTTCTTGTGATCTCGAGATCACAAGAACAACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023158
VALIDATED
CXCL16 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 16
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023158.6-1246s21c1
Sequence:CCGGCTCTGGTACACTCCTGTTGAACTCGAGTTCAACAGGAGTGTACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023158.6-681s21c1
Sequence:CCGGGCAGGGTACTTTGGATCACATCTCGAGATGTGATCCAAAGTACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023158.6-631s21c1
Sequence:CCGGGCTGGAAGTTGTTCTTGTGATCTCGAGATCACAAGAACAACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023158.6-1069s21c1
Sequence:CCGGGAGGCAAATGAGAAACAGCAACTCGAGTTGCTGTTTCTCATTTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023158.6-799s21c1
Sequence:CCGGCGTGAACTAGTGGACTGCTTTCTCGAGAAAGCAGTCCACTAGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023158.3-230s1c1
Sequence:CCGGGCAGGGTACTTTGGATCACATCTCGAGATGTGATCCAAAGTACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023158.3-348s1c1
Sequence:CCGGCGTGAACTAGTGGACTGCTTTCTCGAGAAAGCAGTCCACTAGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023158.3-618s1c1
Sequence:CCGGGAGGCAAATGAGAAACAGCAACTCGAGTTGCTGTTTCTCATTTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023158.3-795s1c1
Sequence:CCGGCTCTGGTACACTCCTGTTGAACTCGAGTTCAACAGGAGTGTACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023158.3-180s1c1
Sequence:CCGGGCTGGAAGTTGTTCTTGTGATCTCGAGATCACAAGAACAACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023158
VALIDATED
CXCL16 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 16
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023158.6-1246s21c1
Sequence:CCGGCTCTGGTACACTCCTGTTGAACTCGAGTTCAACAGGAGTGTACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023158.6-681s21c1
Sequence:CCGGGCAGGGTACTTTGGATCACATCTCGAGATGTGATCCAAAGTACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023158.6-631s21c1
Sequence:CCGGGCTGGAAGTTGTTCTTGTGATCTCGAGATCACAAGAACAACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023158.6-1069s21c1
Sequence:CCGGGAGGCAAATGAGAAACAGCAACTCGAGTTGCTGTTTCTCATTTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023158.6-799s21c1
Sequence:CCGGCGTGAACTAGTGGACTGCTTTCTCGAGAAAGCAGTCCACTAGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023158.3-230s1c1
Sequence:CCGGGCAGGGTACTTTGGATCACATCTCGAGATGTGATCCAAAGTACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023158.3-348s1c1
Sequence:CCGGCGTGAACTAGTGGACTGCTTTCTCGAGAAAGCAGTCCACTAGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023158.3-618s1c1
Sequence:CCGGGAGGCAAATGAGAAACAGCAACTCGAGTTGCTGTTTCTCATTTGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023158.3-795s1c1
Sequence:CCGGCTCTGGTACACTCCTGTTGAACTCGAGTTCAACAGGAGTGTACCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065695    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023158.3-180s1c1
Sequence:CCGGGCTGGAAGTTGTTCTTGTGATCTCGAGATCACAAGAACAACTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks