EMAIL THIS PAGE TO A FRIEND

CXCL17

chemokine (C-X-C motif) ligand 17

Synonyms: DMC Dcip1 UNQ473 VCC-1 VCC1
UniProtKB ID: Q6UXB2, A8KAC0
Gene ID:
Mouse(232983) chemokine (C-X-C motif) ligand 17
Rat(308436) chemokine (C-X-C motif) ligand 17
domestic cat(101086020) chemokine (C-X-C motif) ligand 17
cow(788717) chemokine (C-X-C motif) ligand 17
dog(100687408) chemokine (C-X-C motif) ligand 17
domestic guinea pig(100734695) chemokine (C-X-C motif) ligand 17
naked mole-rat(101708913) chemokine (C-X-C motif) ligand 17
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302002 ANTI-VCC1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

Proteins

Product # Description Species Add to Cart
 
SRP6357 CXCL17 human recombinant, expressed in E. coli, ≥85% (SDS-PAGE) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153576 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153576 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153576 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198477 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198477 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198477 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198477 Rosetta Predictions human pricing
NM_001107491 Rosetta Predictions rat pricing
NM_153576 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046228 predicted 465
2 SASI_Hs01_00046229 predicted 289
3 SASI_Hs01_00046230 predicted 523
4 SASI_Hs01_00046231 predicted 492
5 SASI_Hs01_00046232 predicted 515
6 SASI_Hs01_00046233 predicted 381
7 SASI_Hs01_00046234 predicted 436
8 SASI_Hs01_00046235 predicted 483
9 SASI_Hs01_00046236 predicted 338
10 SASI_Hs01_00046237 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107491 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229355 predicted 305
2 SASI_Rn02_00229356 predicted 372
3 SASI_Rn02_00229357 predicted 470
4 SASI_Rn02_00229358 predicted 459
5 SASI_Rn02_00229359 predicted 232
6 SASI_Rn02_00229360 predicted 479
7 SASI_Rn02_00229361 predicted 512
8 SASI_Rn02_00229362 predicted 390
9 SASI_Rn02_00229363 predicted 561
10 SASI_Rn02_00229364 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153576 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023547 predicted 690
2 SASI_Mm01_00023548 predicted 631
3 SASI_Mm01_00023549 predicted 468
4 SASI_Mm01_00023550 predicted 143
5 SASI_Mm01_00023551 predicted 626
6 SASI_Mm01_00023553 predicted 632
7 SASI_Mm01_00023554 predicted 455
8 SASI_Mm01_00023555 predicted 621
9 SASI_Mm01_00023556 predicted 422
10 SASI_Mm02_00343382 predicted 247
11 SASI_Mm01_00023552 predicted 581
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153576
CXCL17 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 17
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153576.1-415s1c1
Sequence:CCGGGCCAGCAATTTCTCAAACGATCTCGAGATCGTTTGAGAAATTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153576.1-261s1c1
Sequence:CCGGGCAAAGATTGGTTCCTGCAAGCTCGAGCTTGCAGGAACCAATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153576.1-449s1c1
Sequence:CCGGCTTTGCGCTGCCCTTATAGTACTCGAGTACTATAAGGGCAGCGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153576.2-520s21c1
Sequence:CCGGGCCCTAGCACGGTTCTTATTCCTCGAGGAATAAGAACCGTGCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153576.2-250s21c1
Sequence:CCGGAGAATGTGAATGCAAAGATTGCTCGAGCAATCTTTGCATTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153576.2-404s21c1
Sequence:CCGGTCCAGAGCCTGCCAGCAATTTCTCGAGAAATTGCTGGCAGGCTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153576.2-328s21c1
Sequence:CCGGGTGTCCCTGTGATCACGTCAACTCGAGTTGACGTGATCACAGGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153576
CXCL17 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 17
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153576.1-415s1c1
Sequence:CCGGGCCAGCAATTTCTCAAACGATCTCGAGATCGTTTGAGAAATTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153576.1-261s1c1
Sequence:CCGGGCAAAGATTGGTTCCTGCAAGCTCGAGCTTGCAGGAACCAATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153576.1-449s1c1
Sequence:CCGGCTTTGCGCTGCCCTTATAGTACTCGAGTACTATAAGGGCAGCGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153576.2-520s21c1
Sequence:CCGGGCCCTAGCACGGTTCTTATTCCTCGAGGAATAAGAACCGTGCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153576.2-250s21c1
Sequence:CCGGAGAATGTGAATGCAAAGATTGCTCGAGCAATCTTTGCATTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153576.2-404s21c1
Sequence:CCGGTCCAGAGCCTGCCAGCAATTTCTCGAGAAATTGCTGGCAGGCTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153576.2-328s21c1
Sequence:CCGGGTGTCCCTGTGATCACGTCAACTCGAGTTGACGTGATCACAGGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153576
CXCL17 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 17
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153576.1-415s1c1
Sequence:CCGGGCCAGCAATTTCTCAAACGATCTCGAGATCGTTTGAGAAATTGCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153576.1-261s1c1
Sequence:CCGGGCAAAGATTGGTTCCTGCAAGCTCGAGCTTGCAGGAACCAATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184757    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153576.1-449s1c1
Sequence:CCGGCTTTGCGCTGCCCTTATAGTACTCGAGTACTATAAGGGCAGCGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153576.2-520s21c1
Sequence:CCGGGCCCTAGCACGGTTCTTATTCCTCGAGGAATAAGAACCGTGCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153576.2-250s21c1
Sequence:CCGGAGAATGTGAATGCAAAGATTGCTCGAGCAATCTTTGCATTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153576.2-404s21c1
Sequence:CCGGTCCAGAGCCTGCCAGCAATTTCTCGAGAAATTGCTGGCAGGCTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153576.2-328s21c1
Sequence:CCGGGTGTCCCTGTGATCACGTCAACTCGAGTTGACGTGATCACAGGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198477
CXCL17 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 17
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198477.1-439s1c1
Sequence:CCGGCAAACAAGCATTCCAGAGCCTCTCGAGAGGCTCTGGAATGCTTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198477.1-481s1c1
Sequence:CCGGGTCAGCTAAGAAGCTTTGCTCCTCGAGGAGCAAAGCTTCTTAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198477.1-431s1c1
Sequence:CCGGCAGAAAGCCAAACAAGCATTCCTCGAGGAATGCTTGTTTGGCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198477.1-471s1c1
Sequence:CCGGCTCAAACAATGTCAGCTAAGACTCGAGTCTTAGCTGACATTGTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198477.1-473s1c1
Sequence:CCGGCAAACAATGTCAGCTAAGAAGCTCGAGCTTCTTAGCTGACATTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198477.1-384s1c1
Sequence:CCGGGATCATTTCAAGGGCAATGTGCTCGAGCACATTGCCCTTGAAATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198477.1-522s21c1
Sequence:CCGGGCGCCCACTCTTCCAATTAAACTCGAGTTTAATTGGAAGAGTGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198477.1-296s21c1
Sequence:CCGGAGAATGTGAGTGCAAAGATTGCTCGAGCAATCTTTGCACTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198477.1-208s21c1
Sequence:CCGGTGGTCTCTAGCAGCCTGAATCCTCGAGGATTCAGGCTGCTAGAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198477
CXCL17 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 17
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198477.1-439s1c1
Sequence:CCGGCAAACAAGCATTCCAGAGCCTCTCGAGAGGCTCTGGAATGCTTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198477.1-481s1c1
Sequence:CCGGGTCAGCTAAGAAGCTTTGCTCCTCGAGGAGCAAAGCTTCTTAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198477.1-431s1c1
Sequence:CCGGCAGAAAGCCAAACAAGCATTCCTCGAGGAATGCTTGTTTGGCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198477.1-471s1c1
Sequence:CCGGCTCAAACAATGTCAGCTAAGACTCGAGTCTTAGCTGACATTGTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198477.1-473s1c1
Sequence:CCGGCAAACAATGTCAGCTAAGAAGCTCGAGCTTCTTAGCTGACATTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198477.1-384s1c1
Sequence:CCGGGATCATTTCAAGGGCAATGTGCTCGAGCACATTGCCCTTGAAATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198477.1-522s21c1
Sequence:CCGGGCGCCCACTCTTCCAATTAAACTCGAGTTTAATTGGAAGAGTGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198477.1-296s21c1
Sequence:CCGGAGAATGTGAGTGCAAAGATTGCTCGAGCAATCTTTGCACTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198477.1-208s21c1
Sequence:CCGGTGGTCTCTAGCAGCCTGAATCCTCGAGGATTCAGGCTGCTAGAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198477
CXCL17 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 17
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198477.1-439s1c1
Sequence:CCGGCAAACAAGCATTCCAGAGCCTCTCGAGAGGCTCTGGAATGCTTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198477.1-481s1c1
Sequence:CCGGGTCAGCTAAGAAGCTTTGCTCCTCGAGGAGCAAAGCTTCTTAGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198477.1-431s1c1
Sequence:CCGGCAGAAAGCCAAACAAGCATTCCTCGAGGAATGCTTGTTTGGCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198477.1-471s1c1
Sequence:CCGGCTCAAACAATGTCAGCTAAGACTCGAGTCTTAGCTGACATTGTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198477.1-473s1c1
Sequence:CCGGCAAACAATGTCAGCTAAGAAGCTCGAGCTTCTTAGCTGACATTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198477.1-384s1c1
Sequence:CCGGGATCATTTCAAGGGCAATGTGCTCGAGCACATTGCCCTTGAAATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198477.1-522s21c1
Sequence:CCGGGCGCCCACTCTTCCAATTAAACTCGAGTTTAATTGGAAGAGTGGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198477.1-296s21c1
Sequence:CCGGAGAATGTGAGTGCAAAGATTGCTCGAGCAATCTTTGCACTCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198477.1-208s21c1
Sequence:CCGGTGGTCTCTAGCAGCCTGAATCCTCGAGGATTCAGGCTGCTAGAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks