EMAIL THIS PAGE TO A FRIEND

CXCL1

chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha)

93 Gene Product Result for
Synonyms: FSP GRO1 GROa MGSA MGSA-a NAP-3 SCYB1
UniProtKB ID: P09341, Q9UCR7
Gene ID:
Human(2919) Summary: This gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signal through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. Aberrant expression this protein is associated with the growth and progression of certain tumors. A naturally occurring processed form of this protein has increased chemotactic activity. Alternate splicing results in coding and non-coding variants of this gene. A pseudogene of this gene is found on chromosome 4. [provided by RefSeq, Jan 2012]
Mouse(14825) chemokine (C-X-C motif) ligand 1
Rat(81503) chemokine (C-X-C motif) ligand 1
Horse(100034121) chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha)
sheep(443380) chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha)
domestic guinea pig(100135510) chemokine (C-X-C motif) ligand 1
naked mole-rat(101705558) chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha)
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001511 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001511 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001511 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008176 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008176 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008176 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001511 Rosetta Predictions human pricing
NM_030845 Rosetta Predictions rat pricing
NM_008176 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001511 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095009 predicted 317
2 SASI_Hs01_00095010 predicted 313
3 SASI_Hs01_00095011 predicted 415
4 SASI_Hs01_00095013 predicted 417
5 SASI_Hs02_00332014 predicted 366
6 SASI_Hs01_00095016 predicted 398
7 SASI_Hs02_00332015 predicted 626
8 SASI_Hs02_00332016 predicted 616
9 SASI_Hs02_00332017 predicted 634
10 SASI_Hs02_00332018 predicted 636
11 SASI_Hs01_00095008 predicted 506
12 SASI_Hs01_00095012 predicted 502
13 SASI_Hs01_00095014 predicted 504
14 SASI_Hs01_00095015 predicted 450
15 SASI_Hs01_00095017 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030845 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083145 predicted 505
2 SASI_Rn01_00083147 predicted 542
3 SASI_Rn01_00083148 predicted 387
4 SASI_Rn01_00083149 predicted 659
5 SASI_Rn01_00083150 predicted 677
6 SASI_Rn01_00083151 predicted 565
7 SASI_Rn01_00083152 predicted 375
8 SASI_Rn01_00083153 predicted 421
9 SASI_Rn01_00083154 predicted 571
10 SASI_Rn02_00264075 predicted 509
11 SASI_Rn01_00083146 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008176 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104189 predicted 634
2 SASI_Mm01_00104190 predicted 484
3 SASI_Mm01_00104191 predicted 546
4 SASI_Mm01_00104192 predicted 225
5 SASI_Mm01_00104193 predicted 341
6 SASI_Mm01_00104194 predicted 461
7 SASI_Mm01_00104195 predicted 338
8 SASI_Mm01_00104196 predicted 229
9 SASI_Mm01_00104198 predicted 594
10 SASI_Mm02_00313304 predicted 548
11 SASI_Mm01_00104197 predicted 596
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001511
CXCL1 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001511.1-450s1c1
Sequence:CCGGCCTGCCCTTATAGGAACAGAACTCGAGTTCTGTTCCTATAAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001511.1-323s1c1
Sequence:CCGGCGGAAAGCTTGCCTCAATCCTCTCGAGAGGATTGAGGCAAGCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001511.1-247s1c1
Sequence:CCGGCATCCAAAGTGTGAACGTGAACTCGAGTTCACGTTCACACTTTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001511.1-375s1c1
Sequence:CCGGAGATGCTGAACAGTGACAAATCTCGAGATTTGTCACTGTTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001511.1-379s1c1
Sequence:CCGGGCTGAACAGTGACAAATCCAACTCGAGTTGGATTTGTCACTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001511.1-629s21c1
Sequence:CCGGACCTGCACACTGTCCTATTATCTCGAGATAATAGGACAGTGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001511.1-808s21c1
Sequence:CCGGCAAATGGCCAATGAGATCATTCTCGAGAATGATCTCATTGGCCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001511.1-730s21c1
Sequence:CCGGGTTCTCCAGTCATTATGTTAACTCGAGTTAACATAATGACTGGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001511
CXCL1 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001511.1-450s1c1
Sequence:CCGGCCTGCCCTTATAGGAACAGAACTCGAGTTCTGTTCCTATAAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001511.1-323s1c1
Sequence:CCGGCGGAAAGCTTGCCTCAATCCTCTCGAGAGGATTGAGGCAAGCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001511.1-247s1c1
Sequence:CCGGCATCCAAAGTGTGAACGTGAACTCGAGTTCACGTTCACACTTTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001511.1-375s1c1
Sequence:CCGGAGATGCTGAACAGTGACAAATCTCGAGATTTGTCACTGTTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001511.1-379s1c1
Sequence:CCGGGCTGAACAGTGACAAATCCAACTCGAGTTGGATTTGTCACTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001511.1-629s21c1
Sequence:CCGGACCTGCACACTGTCCTATTATCTCGAGATAATAGGACAGTGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001511.1-808s21c1
Sequence:CCGGCAAATGGCCAATGAGATCATTCTCGAGAATGATCTCATTGGCCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001511.1-730s21c1
Sequence:CCGGGTTCTCCAGTCATTATGTTAACTCGAGTTAACATAATGACTGGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001511
CXCL1 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001511.1-450s1c1
Sequence:CCGGCCTGCCCTTATAGGAACAGAACTCGAGTTCTGTTCCTATAAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001511.1-323s1c1
Sequence:CCGGCGGAAAGCTTGCCTCAATCCTCTCGAGAGGATTGAGGCAAGCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001511.1-247s1c1
Sequence:CCGGCATCCAAAGTGTGAACGTGAACTCGAGTTCACGTTCACACTTTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001511.1-375s1c1
Sequence:CCGGAGATGCTGAACAGTGACAAATCTCGAGATTTGTCACTGTTCAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001511.1-379s1c1
Sequence:CCGGGCTGAACAGTGACAAATCCAACTCGAGTTGGATTTGTCACTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001511.1-629s21c1
Sequence:CCGGACCTGCACACTGTCCTATTATCTCGAGATAATAGGACAGTGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371953    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001511.1-808s21c1
Sequence:CCGGCAAATGGCCAATGAGATCATTCTCGAGAATGATCTCATTGGCCATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371954    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001511.1-730s21c1
Sequence:CCGGGTTCTCCAGTCATTATGTTAACTCGAGTTAACATAATGACTGGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008176
CXCL1 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008176.1-654s1c1
Sequence:CCGGGCTGTGTTTGTATGTCTTGAACTCGAGTTCAAGACATACAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008176.1-107s1c1
Sequence:CCGGCTGCAGACCATGGCTGGGATTCTCGAGAATCCCAGCCATGGTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008176.1-236s1c1
Sequence:CCGGGAAGCTCCCTTGGTTCAGAAACTCGAGTTTCTGAACCAAGGGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008176.1-124s1c1
Sequence:CCGGGATTCACCTCAAGAACATCCACTCGAGTGGATGTTCTTGAGGTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008176.1-130s1c1
Sequence:CCGGCCTCAAGAACATCCAGAGCTTCTCGAGAAGCTCTGGATGTTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008176.2-204s21c1
Sequence:CCGGTCAAGAATGGTCGCGAGGCTTCTCGAGAAGCCTCGCGACCATTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008176.2-288s21c1
Sequence:CCGGAGTAACGGAGAAAGAAGACAGCTCGAGCTGTCTTCTTTCTCCGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008176.2-182s21c1
Sequence:CCGGCAAACCGAAGTCATAGCCACACTCGAGTGTGGCTATGACTTCGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008176.2-80s21c1
Sequence:CCGGATCGCCAATGAGCTGCGCTGTCTCGAGACAGCGCAGCTCATTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008176.2-590s21c1
Sequence:CCGGAGTGCAGAGAGATAGAGTTTACTCGAGTAAACTCTATCTCTCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008176
CXCL1 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008176.1-654s1c1
Sequence:CCGGGCTGTGTTTGTATGTCTTGAACTCGAGTTCAAGACATACAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008176.1-107s1c1
Sequence:CCGGCTGCAGACCATGGCTGGGATTCTCGAGAATCCCAGCCATGGTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008176.1-236s1c1
Sequence:CCGGGAAGCTCCCTTGGTTCAGAAACTCGAGTTTCTGAACCAAGGGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008176.1-124s1c1
Sequence:CCGGGATTCACCTCAAGAACATCCACTCGAGTGGATGTTCTTGAGGTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008176.1-130s1c1
Sequence:CCGGCCTCAAGAACATCCAGAGCTTCTCGAGAAGCTCTGGATGTTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008176.2-204s21c1
Sequence:CCGGTCAAGAATGGTCGCGAGGCTTCTCGAGAAGCCTCGCGACCATTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008176.2-288s21c1
Sequence:CCGGAGTAACGGAGAAAGAAGACAGCTCGAGCTGTCTTCTTTCTCCGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008176.2-182s21c1
Sequence:CCGGCAAACCGAAGTCATAGCCACACTCGAGTGTGGCTATGACTTCGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008176.2-80s21c1
Sequence:CCGGATCGCCAATGAGCTGCGCTGTCTCGAGACAGCGCAGCTCATTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008176.2-590s21c1
Sequence:CCGGAGTGCAGAGAGATAGAGTTTACTCGAGTAAACTCTATCTCTCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008176
CXCL1 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008176.1-654s1c1
Sequence:CCGGGCTGTGTTTGTATGTCTTGAACTCGAGTTCAAGACATACAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008176.1-107s1c1
Sequence:CCGGCTGCAGACCATGGCTGGGATTCTCGAGAATCCCAGCCATGGTCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008176.1-236s1c1
Sequence:CCGGGAAGCTCCCTTGGTTCAGAAACTCGAGTTTCTGAACCAAGGGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008176.1-124s1c1
Sequence:CCGGGATTCACCTCAAGAACATCCACTCGAGTGGATGTTCTTGAGGTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008176.1-130s1c1
Sequence:CCGGCCTCAAGAACATCCAGAGCTTCTCGAGAAGCTCTGGATGTTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008176.2-204s21c1
Sequence:CCGGTCAAGAATGGTCGCGAGGCTTCTCGAGAAGCCTCGCGACCATTCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008176.2-288s21c1
Sequence:CCGGAGTAACGGAGAAAGAAGACAGCTCGAGCTGTCTTCTTTCTCCGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008176.2-182s21c1
Sequence:CCGGCAAACCGAAGTCATAGCCACACTCGAGTGTGGCTATGACTTCGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008176.2-80s21c1
Sequence:CCGGATCGCCAATGAGCTGCGCTGTCTCGAGACAGCGCAGCTCATTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262971    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008176.2-590s21c1
Sequence:CCGGAGTGCAGAGAGATAGAGTTTACTCGAGTAAACTCTATCTCTCTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks