EMAIL THIS PAGE TO A FRIEND

CXCL2

chemokine (C-X-C motif) ligand 2

Synonyms: CINC-2a GRO2 GROb MGSA-b MIP-2a MIP2 MIP2A SCYB2
UniProtKB ID: P19875, Q6FGD6, Q9UPB8
Gene ID:
Mouse(20310) chemokine (C-X-C motif) ligand 2
Rat(114105) chemokine (C-X-C motif) ligand 2
cow(281214) chemokine (C-X-C motif) ligand 2
Horse(100233237) chemokine (C-X-C motif) ligand 2
cow(281734) chemokine (C-X-C motif) ligand 2
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002089 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002089 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002089 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009140 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009140 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009140 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU159251 MISSION® esiRNA esiRNA targeting mouse Cxcl2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002089 Rosetta Predictions human pricing
NM_053647 Rosetta Predictions rat pricing
NM_009140 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157852 predicted 869
2 SASI_Hs01_00157855 predicted 912
3 SASI_Hs02_00333176 predicted 864
4 SASI_Hs01_00157856 predicted 923
5 SASI_Hs01_00157858 predicted 922
6 SASI_Hs01_00157860 predicted 764
7 SASI_Hs02_00333177 predicted 813
8 SASI_Hs02_00333178 predicted 825
9 SASI_Hs02_00333179 predicted 499
10 SASI_Hs02_00333180 predicted 803
11 SASI_Hs01_00157851 predicted 789
12 SASI_Hs01_00157853 predicted 828
13 SASI_Hs01_00157854 predicted 832
14 SASI_Hs01_00157857 predicted 811
15 SASI_Hs01_00157859 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053647 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094410 predicted 197
2 SASI_Rn01_00094411 predicted 627
3 SASI_Rn01_00094412 predicted 572
4 SASI_Rn01_00094413 predicted 639
5 SASI_Rn01_00094414 predicted 354
6 SASI_Rn01_00094415 predicted 537
7 SASI_Rn01_00094416 predicted 606
8 SASI_Rn01_00094417 predicted 341
9 SASI_Rn01_00094418 predicted 635
10 SASI_Rn01_00094419 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175505 predicted 706
2 SASI_Mm01_00175506 predicted 788
3 SASI_Mm01_00175507 predicted 816
4 SASI_Mm02_00315445 predicted 805
5 SASI_Mm01_00175510 predicted 786
6 SASI_Mm02_00315446 predicted 251
7 SASI_Mm01_00175512 predicted 806
8 SASI_Mm01_00175513 predicted 550
9 SASI_Mm02_00315447 predicted 549
10 SASI_Mm02_00315448 predicted 363
11 SASI_Mm01_00175508 predicted 813
12 SASI_Mm01_00175509 predicted 849
13 SASI_Mm01_00175511 predicted 793
14 SASI_Mm01_00175514 predicted 556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002089
VALIDATED
CXCL2 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002089.3-749s21c1
Sequence:CCGGTTTAGGTCAAACCCAAGTTAGCTCGAGCTAACTTGGGTTTGACCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002089.3-837s21c1
Sequence:CCGGATTTCTTCGTGATGACATATCCTCGAGGATATGTCATCACGAAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_002089.3-716s21c1
Sequence:CCGGCTTGCACACTCTCCCATTATACTCGAGTATAATGGGAGAGTGTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002089.1-221s1c1
Sequence:CCGGGCAGGGAATTCACCTCAAGAACTCGAGTTCTTGAGGTGAATTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002089.1-722s1c1
Sequence:CCGGGCAGATATTCTCTAGTCATTTCTCGAGAAATGACTAGAGAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002089.1-303s1c1
Sequence:CCGGACACTCAAGAATGGGCAGAAACTCGAGTTTCTGCCCATTCTTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002089.1-339s1c1
Sequence:CCGGGCATCGCCCATGGTTAAGAAACTCGAGTTTCTTAACCATGGGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002089
VALIDATED
CXCL2 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002089.3-749s21c1
Sequence:CCGGTTTAGGTCAAACCCAAGTTAGCTCGAGCTAACTTGGGTTTGACCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002089.3-837s21c1
Sequence:CCGGATTTCTTCGTGATGACATATCCTCGAGGATATGTCATCACGAAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_002089.3-716s21c1
Sequence:CCGGCTTGCACACTCTCCCATTATACTCGAGTATAATGGGAGAGTGTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002089.1-221s1c1
Sequence:CCGGGCAGGGAATTCACCTCAAGAACTCGAGTTCTTGAGGTGAATTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002089.1-722s1c1
Sequence:CCGGGCAGATATTCTCTAGTCATTTCTCGAGAAATGACTAGAGAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002089.1-303s1c1
Sequence:CCGGACACTCAAGAATGGGCAGAAACTCGAGTTTCTGCCCATTCTTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002089.1-339s1c1
Sequence:CCGGGCATCGCCCATGGTTAAGAAACTCGAGTTTCTTAACCATGGGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002089
VALIDATED
CXCL2 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372017    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002089.3-749s21c1
Sequence:CCGGTTTAGGTCAAACCCAAGTTAGCTCGAGCTAACTTGGGTTTGACCTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002089.3-837s21c1
Sequence:CCGGATTTCTTCGTGATGACATATCCTCGAGGATATGTCATCACGAAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_002089.3-716s21c1
Sequence:CCGGCTTGCACACTCTCCCATTATACTCGAGTATAATGGGAGAGTGTGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002089.1-221s1c1
Sequence:CCGGGCAGGGAATTCACCTCAAGAACTCGAGTTCTTGAGGTGAATTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002089.1-722s1c1
Sequence:CCGGGCAGATATTCTCTAGTCATTTCTCGAGAAATGACTAGAGAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002089.1-303s1c1
Sequence:CCGGACACTCAAGAATGGGCAGAAACTCGAGTTTCTGCCCATTCTTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002089.1-339s1c1
Sequence:CCGGGCATCGCCCATGGTTAAGAAACTCGAGTTTCTTAACCATGGGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009140
CXCL2 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009140.1-172s1c1
Sequence:CCGGGCCAAGGGTTGACTTCAAGAACTCGAGTTCTTGAAGTCAACCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009140.1-252s1c1
Sequence:CCGGCCACTCTCAAGGGCGGTCAAACTCGAGTTTGACCGCCCTTGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009140.1-137s1c1
Sequence:CCGGGCCAGTGAACTGCGCTGTCAACTCGAGTTGACAGCGCAGTTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009140.1-166s1c1
Sequence:CCGGGACCCTGCCAAGGGTTGACTTCTCGAGAAGTCAACCCTTGGCAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009140.1-325s1c1
Sequence:CCGGACTGAACAAAGGCAAGGCTAACTCGAGTTAGCCTTGCCTTTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009140
CXCL2 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009140.1-172s1c1
Sequence:CCGGGCCAAGGGTTGACTTCAAGAACTCGAGTTCTTGAAGTCAACCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009140.1-252s1c1
Sequence:CCGGCCACTCTCAAGGGCGGTCAAACTCGAGTTTGACCGCCCTTGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009140.1-137s1c1
Sequence:CCGGGCCAGTGAACTGCGCTGTCAACTCGAGTTGACAGCGCAGTTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009140.1-166s1c1
Sequence:CCGGGACCCTGCCAAGGGTTGACTTCTCGAGAAGTCAACCCTTGGCAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009140.1-325s1c1
Sequence:CCGGACTGAACAAAGGCAAGGCTAACTCGAGTTAGCCTTGCCTTTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009140
CXCL2 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009140.1-172s1c1
Sequence:CCGGGCCAAGGGTTGACTTCAAGAACTCGAGTTCTTGAAGTCAACCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009140.1-252s1c1
Sequence:CCGGCCACTCTCAAGGGCGGTCAAACTCGAGTTTGACCGCCCTTGAGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009140.1-137s1c1
Sequence:CCGGGCCAGTGAACTGCGCTGTCAACTCGAGTTGACAGCGCAGTTCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009140.1-166s1c1
Sequence:CCGGGACCCTGCCAAGGGTTGACTTCTCGAGAAGTCAACCCTTGGCAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009140.1-325s1c1
Sequence:CCGGACTGAACAAAGGCAAGGCTAACTCGAGTTAGCCTTGCCTTTGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks