EMAIL THIS PAGE TO A FRIEND

CXCL3

chemokine (C-X-C motif) ligand 3

70 Gene Product Result for
Synonyms: CINC-2b GRO3 GROg MIP-2b MIP2B SCYB3
UniProtKB ID: P19876, Q4W5H9
Gene ID:
Mouse(330122) chemokine (C-X-C motif) ligand 3
Rat(171551) chemokine (C-X-C motif) ligand 3
cow(613667) chemokine (C-X-C motif) ligand 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1889 Rat CINC-2 ELISA for serum, plasma and cell culture supernatants rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203320 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_203320 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_203320 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002090 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002090 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002090 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147761 MISSION® esiRNA esiRNA human CXCL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002090 Rosetta Predictions human pricing
NM_138522 Rosetta Predictions rat pricing
NM_203320 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002090 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333181 predicted 628
2 SASI_Hs01_00202867 predicted 320
3 SASI_Hs01_00202868 predicted 598
4 SASI_Hs01_00202869 predicted 499
5 SASI_Hs01_00202870 predicted 545
6 SASI_Hs01_00202871 predicted 596
7 SASI_Hs01_00202872 predicted 472
8 SASI_Hs01_00202873 predicted 490
9 SASI_Hs01_00202874 predicted 597
10 SASI_Hs01_00202875 predicted 501
11 SASI_Hs01_00202876 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138522 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050436 predicted 441
2 SASI_Rn01_00050437 predicted 341
3 SASI_Rn01_00050439 predicted 370
4 SASI_Rn01_00050441 predicted 309
5 SASI_Rn01_00050442 predicted 426
6 SASI_Rn01_00050443 predicted 404
7 SASI_Rn02_00268140 predicted 316
8 SASI_Rn01_00050444 predicted 325
9 SASI_Rn02_00268141 predicted 205
10 SASI_Rn01_00050445 predicted 316
11 SASI_Rn01_00050438 predicted 384
12 SASI_Rn01_00050440 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203320 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047205 predicted 477
2 SASI_Mm01_00047206 predicted 398
3 SASI_Mm01_00047207 predicted 629
4 SASI_Mm01_00047209 predicted 727
5 SASI_Mm01_00047210 predicted 638
6 SASI_Mm01_00047211 predicted 547
7 SASI_Mm01_00047212 predicted 723
8 SASI_Mm01_00047214 predicted 430
9 SASI_Mm02_00351762 predicted 590
10 SASI_Mm02_00351763 predicted 742
11 SASI_Mm01_00047208 predicted 536
12 SASI_Mm01_00047213 predicted 654
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203320
CXCL3 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203320.1-188s1c1
Sequence:CCGGCACCCTACCAAGGGTTGATTTCTCGAGAAATCAACCCTTGGTAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203320.1-341s1c1
Sequence:CCGGGAAGATACTGAAGAGCGGCAACTCGAGTTGCCGCTCTTCAGTATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203320.1-323s1c1
Sequence:CCGGGCTTCAGATAATCATCAAGAACTCGAGTTCTTGATGATTATCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203320.1-276s1c1
Sequence:CCGGACTCTCAAGGATGGTCAAGAACTCGAGTTCTTGACCATCCTTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203320.1-287s1c1
Sequence:CCGGTGGTCAAGAAGTTTGCCTCAACTCGAGTTGAGGCAAACTTCTTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203320
CXCL3 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203320.1-188s1c1
Sequence:CCGGCACCCTACCAAGGGTTGATTTCTCGAGAAATCAACCCTTGGTAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203320.1-341s1c1
Sequence:CCGGGAAGATACTGAAGAGCGGCAACTCGAGTTGCCGCTCTTCAGTATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203320.1-323s1c1
Sequence:CCGGGCTTCAGATAATCATCAAGAACTCGAGTTCTTGATGATTATCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203320.1-276s1c1
Sequence:CCGGACTCTCAAGGATGGTCAAGAACTCGAGTTCTTGACCATCCTTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203320.1-287s1c1
Sequence:CCGGTGGTCAAGAAGTTTGCCTCAACTCGAGTTGAGGCAAACTTCTTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203320
CXCL3 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203320.1-188s1c1
Sequence:CCGGCACCCTACCAAGGGTTGATTTCTCGAGAAATCAACCCTTGGTAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203320.1-341s1c1
Sequence:CCGGGAAGATACTGAAGAGCGGCAACTCGAGTTGCCGCTCTTCAGTATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203320.1-323s1c1
Sequence:CCGGGCTTCAGATAATCATCAAGAACTCGAGTTCTTGATGATTATCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203320.1-276s1c1
Sequence:CCGGACTCTCAAGGATGGTCAAGAACTCGAGTTCTTGACCATCCTTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_203320.1-287s1c1
Sequence:CCGGTGGTCAAGAAGTTTGCCTCAACTCGAGTTGAGGCAAACTTCTTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002090
CXCL3 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002090.2-1001s1c1
Sequence:CCGGGCTGAAGTTTCCCTTAGACATCTCGAGATGTCTAAGGGAAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002090.2-329s1c1
Sequence:CCGGACATCCAAAGTGTGAATGTAACTCGAGTTACATTCACACTTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002090.2-402s1c1
Sequence:CCGGTGGGAAGAAAGCTTGTCTCAACTCGAGTTGAGACAAGCTTTCTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002090.2-321s1c1
Sequence:CCGGCCTCAAGAACATCCAAAGTGTCTCGAGACACTTTGGATGTTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002090.2-391s1c1
Sequence:CCGGACACTCAAGAATGGGAAGAAACTCGAGTTTCTTCCCATTCTTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002090.2-482s21c1
Sequence:CCGGACTGACAGGAGAGAAGTAAGACTCGAGTCTTACTTCTCTCCTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002090.2-629s21c1
Sequence:CCGGTTACGAGGGTTCTACTTATTTCTCGAGAAATAAGTAGAACCCTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002090.2-789s21c1
Sequence:CCGGATTTAGTGGGAGACCATAATGCTCGAGCATTATGGTCTCCCACTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002090
CXCL3 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002090.2-1001s1c1
Sequence:CCGGGCTGAAGTTTCCCTTAGACATCTCGAGATGTCTAAGGGAAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002090.2-329s1c1
Sequence:CCGGACATCCAAAGTGTGAATGTAACTCGAGTTACATTCACACTTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002090.2-402s1c1
Sequence:CCGGTGGGAAGAAAGCTTGTCTCAACTCGAGTTGAGACAAGCTTTCTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002090.2-321s1c1
Sequence:CCGGCCTCAAGAACATCCAAAGTGTCTCGAGACACTTTGGATGTTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002090.2-391s1c1
Sequence:CCGGACACTCAAGAATGGGAAGAAACTCGAGTTTCTTCCCATTCTTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002090.2-482s21c1
Sequence:CCGGACTGACAGGAGAGAAGTAAGACTCGAGTCTTACTTCTCTCCTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002090.2-629s21c1
Sequence:CCGGTTACGAGGGTTCTACTTATTTCTCGAGAAATAAGTAGAACCCTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002090.2-789s21c1
Sequence:CCGGATTTAGTGGGAGACCATAATGCTCGAGCATTATGGTCTCCCACTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002090
CXCL3 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002090.2-1001s1c1
Sequence:CCGGGCTGAAGTTTCCCTTAGACATCTCGAGATGTCTAAGGGAAACTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002090.2-329s1c1
Sequence:CCGGACATCCAAAGTGTGAATGTAACTCGAGTTACATTCACACTTTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002090.2-402s1c1
Sequence:CCGGTGGGAAGAAAGCTTGTCTCAACTCGAGTTGAGACAAGCTTTCTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002090.2-321s1c1
Sequence:CCGGCCTCAAGAACATCCAAAGTGTCTCGAGACACTTTGGATGTTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002090.2-391s1c1
Sequence:CCGGACACTCAAGAATGGGAAGAAACTCGAGTTTCTTCCCATTCTTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002090.2-482s21c1
Sequence:CCGGACTGACAGGAGAGAAGTAAGACTCGAGTCTTACTTCTCTCCTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002090.2-629s21c1
Sequence:CCGGTTACGAGGGTTCTACTTATTTCTCGAGAAATAAGTAGAACCCTCGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002090.2-789s21c1
Sequence:CCGGATTTAGTGGGAGACCATAATGCTCGAGCATTATGGTCTCCCACTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks