EMAIL THIS PAGE TO A FRIEND

CXCL5

chemokine (C-X-C motif) ligand 5

169 Gene Product Result for
Synonyms: ENA-78 SCYB5
UniProtKB ID: P42830, Q96QE1
Gene ID:
Human(6374) Summary: This gene encodes a protein that is a member of the CXC subfamily of chemokines. Chemokines, which recruit and activate leukocytes, are classified by function (inflammatory or homeostatic) or by structure. This protein is proposed to bind the G-protein coupled receptor chemokine (C-X-C motif) receptor 2 to recruit neutrophils, to promote angiogenesis and to remodel connective tissues. This protein is thought to play a role in cancer cell proliferation, migration, and invasion. [provided by RefSeq, May 2013]
Mouse(20311) chemokine (C-X-C motif) ligand 5
Rat(60665) chemokine (C-X-C motif) ligand 5
dog(611927) chemokine (C-X-C motif) ligand 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009141 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009141 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009141 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002994 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002994 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002994 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002994 Rosetta Predictions human pricing
NM_022214 Rosetta Predictions rat pricing
NM_009141 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002994 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095694 predicted 848
2 SASI_Hs01_00095696 predicted 784
3 SASI_Hs01_00095697 predicted 861
4 SASI_Hs01_00095695 predicted 793
5 SASI_Hs01_00095699 predicted 764
6 SASI_Hs01_00095701 predicted 680
7 SASI_Hs01_00095702 predicted 648
8 SASI_Hs01_00095703 predicted 688
9 SASI_Hs02_00334869 predicted 713
10 SASI_Hs02_00334870 predicted 376
11 SASI_Hs01_00095698 predicted 889
12 SASI_Hs01_00095700 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022214 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095321 predicted 109
2 SASI_Rn02_00262970 predicted 142
3 SASI_Rn01_00095322 predicted 254
4 SASI_Rn01_00095323 predicted 352
5 SASI_Rn01_00095324 predicted 278
6 SASI_Rn01_00095325 predicted 134
7 SASI_Rn01_00095326 predicted 294
8 SASI_Rn01_00095327 predicted 355
9 SASI_Rn01_00095328 predicted 256
10 SASI_Rn01_00095329 predicted 49
11 SASI_Rn01_00095330 predicted 201
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020882 predicted 383
2 SASI_Mm02_00315449 predicted 563
3 SASI_Mm01_00020883 predicted 306
4 SASI_Mm01_00020886 predicted 283
5 SASI_Mm01_00020887 predicted 667
6 SASI_Mm01_00020888 predicted 429
7 SASI_Mm02_00315450 predicted 522
8 SASI_Mm01_00020889 predicted 677
9 SASI_Mm01_00020891 predicted 736
10 SASI_Mm02_00315451 predicted 287
11 SASI_Mm01_00020884 predicted 261
12 SASI_Mm01_00020885 predicted 858
13 SASI_Mm01_00020890 predicted 601
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009141
VALIDATED
CXCL5 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009141.2-333s21c1
Sequence:CCGGTCCCAAATTGATCGCTAATTTCTCGAGAAATTAGCGATCAATTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009141.2-731s21c1
Sequence:CCGGATCGGAAATTGTGATACTTTACTCGAGTAAAGTATCACAATTTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009141.2-391s21c1
Sequence:CCGGGAAGTCATAGCTAAACTGAAACTCGAGTTTCAGTTTAGCTATGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009141.2-527s21c1
Sequence:CCGGCGGCCAGTGTTCAATAGAAAGCTCGAGCTTTCTATTGAACACTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009141.2-436s21c1
Sequence:CCGGCCAGAAGCTCCTGTGATAAAGCTCGAGCTTTATCACAGGAGCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009141.1-220s1c1
Sequence:CCGGGTTGTGTTTGCTTAACCGTAACTCGAGTTACGGTTAAGCAAACACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009141.1-312s1c1
Sequence:CCGGGAAGTCATAGCTAAACTGAAACTCGAGTTTCAGTTTAGCTATGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009141.1-101s1c1
Sequence:CCGGCAGCGGTTCCAGCTCGCCATTCTCGAGAATGGCGAGCTGGAACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009141.1-423s1c1
Sequence:CCGGCGGAATGCACTCGCAGTGGAACTCGAGTTCCACTGCGAGTGCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009141.1-254s1c1
Sequence:CCGGTCCCAAATTGATCGCTAATTTCTCGAGAAATTAGCGATCAATTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009141
VALIDATED
CXCL5 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009141.2-333s21c1
Sequence:CCGGTCCCAAATTGATCGCTAATTTCTCGAGAAATTAGCGATCAATTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009141.2-731s21c1
Sequence:CCGGATCGGAAATTGTGATACTTTACTCGAGTAAAGTATCACAATTTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009141.2-391s21c1
Sequence:CCGGGAAGTCATAGCTAAACTGAAACTCGAGTTTCAGTTTAGCTATGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009141.2-527s21c1
Sequence:CCGGCGGCCAGTGTTCAATAGAAAGCTCGAGCTTTCTATTGAACACTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009141.2-436s21c1
Sequence:CCGGCCAGAAGCTCCTGTGATAAAGCTCGAGCTTTATCACAGGAGCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009141.1-220s1c1
Sequence:CCGGGTTGTGTTTGCTTAACCGTAACTCGAGTTACGGTTAAGCAAACACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009141.1-312s1c1
Sequence:CCGGGAAGTCATAGCTAAACTGAAACTCGAGTTTCAGTTTAGCTATGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009141.1-101s1c1
Sequence:CCGGCAGCGGTTCCAGCTCGCCATTCTCGAGAATGGCGAGCTGGAACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009141.1-423s1c1
Sequence:CCGGCGGAATGCACTCGCAGTGGAACTCGAGTTCCACTGCGAGTGCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009141.1-254s1c1
Sequence:CCGGTCCCAAATTGATCGCTAATTTCTCGAGAAATTAGCGATCAATTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009141
VALIDATED
CXCL5 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009141.2-333s21c1
Sequence:CCGGTCCCAAATTGATCGCTAATTTCTCGAGAAATTAGCGATCAATTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304244    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009141.2-731s21c1
Sequence:CCGGATCGGAAATTGTGATACTTTACTCGAGTAAAGTATCACAATTTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009141.2-391s21c1
Sequence:CCGGGAAGTCATAGCTAAACTGAAACTCGAGTTTCAGTTTAGCTATGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009141.2-527s21c1
Sequence:CCGGCGGCCAGTGTTCAATAGAAAGCTCGAGCTTTCTATTGAACACTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009141.2-436s21c1
Sequence:CCGGCCAGAAGCTCCTGTGATAAAGCTCGAGCTTTATCACAGGAGCTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009141.1-220s1c1
Sequence:CCGGGTTGTGTTTGCTTAACCGTAACTCGAGTTACGGTTAAGCAAACACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009141.1-312s1c1
Sequence:CCGGGAAGTCATAGCTAAACTGAAACTCGAGTTTCAGTTTAGCTATGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009141.1-101s1c1
Sequence:CCGGCAGCGGTTCCAGCTCGCCATTCTCGAGAATGGCGAGCTGGAACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009141.1-423s1c1
Sequence:CCGGCGGAATGCACTCGCAGTGGAACTCGAGTTCCACTGCGAGTGCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009141.1-254s1c1
Sequence:CCGGTCCCAAATTGATCGCTAATTTCTCGAGAAATTAGCGATCAATTTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002994
VALIDATED
CXCL5 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002994.3-238s21c1
Sequence:CCGGCGCTGCTGTGTTGAGAGAGCTCTCGAGAGCTCTCTCAACACAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_002994.3-376s21c1
Sequence:CCGGCGGGAAGGAAATTTGTCTTGACTCGAGTCAAGACAAATTTCCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002994.3-275s21c1
Sequence:CCGGCAGACCACGCAAGGAGTTCATCTCGAGATGAACTCCTTGCGTGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002994.3-795s21c1
Sequence:CCGGTGAATTGTAGGTGACTATTATCTCGAGATAATAGTCACCTACAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_002994.3-304s21c1
Sequence:CCGGGATCAGTAATCTGCAAGTGTTCTCGAGAACACTTGCAGATTACTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002994.3-266s1c1
Sequence:CCGGGTTTGTTTACAGACCACGCAACTCGAGTTGCGTGGTCTGTAAACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002994.3-304s1c1
Sequence:CCGGGATCAGTAATCTGCAAGTGTTCTCGAGAACACTTGCAGATTACTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002994.3-376s1c1
Sequence:CCGGCGGGAAGGAAATTTGTCTTGACTCGAGTCAAGACAAATTTCCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002994.3-238s1c1
Sequence:CCGGCGCTGCTGTGTTGAGAGAGCTCTCGAGAGCTCTCTCAACACAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002994
VALIDATED
CXCL5 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002994.3-238s21c1
Sequence:CCGGCGCTGCTGTGTTGAGAGAGCTCTCGAGAGCTCTCTCAACACAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_002994.3-376s21c1
Sequence:CCGGCGGGAAGGAAATTTGTCTTGACTCGAGTCAAGACAAATTTCCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002994.3-275s21c1
Sequence:CCGGCAGACCACGCAAGGAGTTCATCTCGAGATGAACTCCTTGCGTGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002994.3-795s21c1
Sequence:CCGGTGAATTGTAGGTGACTATTATCTCGAGATAATAGTCACCTACAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_002994.3-304s21c1
Sequence:CCGGGATCAGTAATCTGCAAGTGTTCTCGAGAACACTTGCAGATTACTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002994.3-266s1c1
Sequence:CCGGGTTTGTTTACAGACCACGCAACTCGAGTTGCGTGGTCTGTAAACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002994.3-304s1c1
Sequence:CCGGGATCAGTAATCTGCAAGTGTTCTCGAGAACACTTGCAGATTACTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002994.3-376s1c1
Sequence:CCGGCGGGAAGGAAATTTGTCTTGACTCGAGTCAAGACAAATTTCCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002994.3-238s1c1
Sequence:CCGGCGCTGCTGTGTTGAGAGAGCTCTCGAGAGCTCTCTCAACACAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002994
VALIDATED
CXCL5 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002994.3-238s21c1
Sequence:CCGGCGCTGCTGTGTTGAGAGAGCTCTCGAGAGCTCTCTCAACACAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_002994.3-376s21c1
Sequence:CCGGCGGGAAGGAAATTTGTCTTGACTCGAGTCAAGACAAATTTCCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002994.3-275s21c1
Sequence:CCGGCAGACCACGCAAGGAGTTCATCTCGAGATGAACTCCTTGCGTGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312612    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_002994.3-795s21c1
Sequence:CCGGTGAATTGTAGGTGACTATTATCTCGAGATAATAGTCACCTACAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_002994.3-304s21c1
Sequence:CCGGGATCAGTAATCTGCAAGTGTTCTCGAGAACACTTGCAGATTACTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002994.3-266s1c1
Sequence:CCGGGTTTGTTTACAGACCACGCAACTCGAGTTGCGTGGTCTGTAAACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002994.3-304s1c1
Sequence:CCGGGATCAGTAATCTGCAAGTGTTCTCGAGAACACTTGCAGATTACTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002994.3-376s1c1
Sequence:CCGGCGGGAAGGAAATTTGTCTTGACTCGAGTCAAGACAAATTTCCTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002994.3-238s1c1
Sequence:CCGGCGCTGCTGTGTTGAGAGAGCTCTCGAGAGCTCTCTCAACACAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks