EMAIL THIS PAGE TO A FRIEND

CXCL6

chemokine (C-X-C motif) ligand 6

48 Gene Product Result for
Synonyms: CKA-3 GCP-2 GCP2 SCYB6
UniProtKB ID: P80162, B2R4X3, Q4W5D4
Gene ID:
domestic guinea pig(100731901) chemokine (C-X-C motif) ligand 6
naked mole-rat(101707377) chemokine (C-X-C motif) ligand 6
Horse(100033988) chemokine (C-X-C motif) ligand 6
cow(281735) chemokine (C-X-C motif) ligand 6 (granulocyte chemotactic protein 2)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002993 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002993 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002993 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002993 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002993 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172531 predicted 805
2 SASI_Hs01_00172532 predicted 592
3 SASI_Hs01_00172533 predicted 891
4 SASI_Hs01_00172534 predicted 555
5 SASI_Hs01_00172535 predicted 571
6 SASI_Hs01_00172536 predicted 211
7 SASI_Hs01_00172538 predicted 560
8 SASI_Hs01_00172539 predicted 678
9 SASI_Hs02_00334868 predicted 513
10 SASI_Hs01_00172540 predicted 586
11 SASI_Hs01_00172537 predicted 647
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002993
CXCL6 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 6
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002993.2-766s1c1
Sequence:CCGGGCTGTGGATTTCGTATGGAAACTCGAGTTTCCATACGAAATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002993.2-350s1c1
Sequence:CCGGCTAAAGAAAGTCATCCAGAAACTCGAGTTTCTGGATGACTTTCTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002993.2-320s1c1
Sequence:CCGGCAAGTTTGTCTGGACCCGGAACTCGAGTTCCGGGTCCAGACAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002993.2-241s1c1
Sequence:CCGGGATTGGTAAACTGCAGGTGTTCTCGAGAACACCTGCAGTTTACCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002993.3-1034s21c1
Sequence:CCGGTTTACCCTAGGATGCTATTTACTCGAGTAAATAGCATCCTAGGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002993.3-513s21c1
Sequence:CCGGTTTGGACAGTGGAAACAAGAACTCGAGTTCTTGTTTCCACTGTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002993
CXCL6 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 6
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002993.2-766s1c1
Sequence:CCGGGCTGTGGATTTCGTATGGAAACTCGAGTTTCCATACGAAATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002993.2-350s1c1
Sequence:CCGGCTAAAGAAAGTCATCCAGAAACTCGAGTTTCTGGATGACTTTCTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002993.2-320s1c1
Sequence:CCGGCAAGTTTGTCTGGACCCGGAACTCGAGTTCCGGGTCCAGACAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002993.2-241s1c1
Sequence:CCGGGATTGGTAAACTGCAGGTGTTCTCGAGAACACCTGCAGTTTACCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002993.3-1034s21c1
Sequence:CCGGTTTACCCTAGGATGCTATTTACTCGAGTAAATAGCATCCTAGGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002993.3-513s21c1
Sequence:CCGGTTTGGACAGTGGAAACAAGAACTCGAGTTCTTGTTTCCACTGTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002993
CXCL6 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 6
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002993.2-766s1c1
Sequence:CCGGGCTGTGGATTTCGTATGGAAACTCGAGTTTCCATACGAAATCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002993.2-350s1c1
Sequence:CCGGCTAAAGAAAGTCATCCAGAAACTCGAGTTTCTGGATGACTTTCTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002993.2-320s1c1
Sequence:CCGGCAAGTTTGTCTGGACCCGGAACTCGAGTTCCGGGTCCAGACAAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002993.2-241s1c1
Sequence:CCGGGATTGGTAAACTGCAGGTGTTCTCGAGAACACCTGCAGTTTACCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372192    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002993.3-1034s21c1
Sequence:CCGGTTTACCCTAGGATGCTATTTACTCGAGTAAATAGCATCCTAGGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002993.3-513s21c1
Sequence:CCGGTTTGGACAGTGGAAACAAGAACTCGAGTTCTTGTTTCCACTGTCCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks