EMAIL THIS PAGE TO A FRIEND

CXCL9

chemokine (C-X-C motif) ligand 9

207 Gene Product Result for
Synonyms: CMK Humig MIG SCYB9 crg-10
UniProtKB ID: Q07325, Q503B4
Gene ID:
Human(4283) Summary: The function of this gene has not been specifically defined; however, it is thought to be involved in T cell trafficking. This gene has been localized to 4q21 with INP10, which is also a member of the chemokine family of cytokines. [provided by RefSeq, Jul 2008]
Mouse(17329) chemokine (C-X-C motif) ligand 9
Rat(246759) chemokine (C-X-C motif) ligand 9
cow(513990) chemokine (C-X-C motif) ligand 9
domestic cat(101100388) chemokine (C-X-C motif) ligand 9
Horse(100057927) chemokine (C-X-C motif) ligand 9
naked mole-rat(101716950) chemokine (C-X-C motif) ligand 9
domestic guinea pig(100714335) chemokine (C-X-C motif) ligand 9
sheep(101108489) chemokine (C-X-C motif) ligand 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008599 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008599 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008599 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002416 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002416 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002416 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159631 MISSION® esiRNA esiRNA human CXCL9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002416 Rosetta Predictions human pricing
NM_145672 Rosetta Predictions rat pricing
NM_008599 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333799 predicted 603
2 SASI_Hs01_00231076 predicted 683
3 SASI_Hs01_00231077 predicted 578
4 SASI_Hs02_00333800 predicted 496
5 SASI_Hs02_00333801 predicted 503
6 SASI_Hs02_00333802 predicted 221
7 SASI_Hs02_00333803 predicted 234
8 SASI_Hs01_00231075 predicted 794
9 SASI_Hs02_00333804 predicted 784
10 SASI_Hs02_00333805 predicted 477
11 SASI_Hs01_00231071 predicted 609
12 SASI_Hs01_00231072 predicted 917
13 SASI_Hs01_00231073 predicted 790
14 SASI_Hs01_00231074 predicted 651
15 SASI_Hs01_00231078 predicted 703
16 SASI_Hs01_00231079 predicted 684
17 SASI_Hs01_00231080 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145672 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268709 predicted 458
2 SASI_Rn02_00268710 predicted 215
3 SASI_Rn02_00268711 predicted 442
4 SASI_Rn02_00268712 predicted 317
5 SASI_Rn02_00268713 predicted 152
6 SASI_Rn02_00268714 predicted 101
7 SASI_Rn02_00268715 predicted 127
8 SASI_Rn02_00268716 predicted 198
9 SASI_Rn02_00268717 predicted 311
10 SASI_Rn02_00268718 predicted 139
11 SASI_Rn01_00036295 predicted 701
12 SASI_Rn01_00036296 predicted 642
13 SASI_Rn01_00036297 predicted 682
14 SASI_Rn01_00036298 predicted 834
15 SASI_Rn01_00036299 predicted 666
16 SASI_Rn01_00036300 predicted 908
17 SASI_Rn01_00036301 predicted 603
18 SASI_Rn01_00036302 predicted 846
19 SASI_Rn01_00036303 predicted 688
20 SASI_Rn01_00036304 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008599 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138012 predicted 609
2 SASI_Mm02_00314252 predicted 641
3 SASI_Mm01_00138011 predicted 672
4 SASI_Mm02_00314253 predicted 514
5 SASI_Mm02_00314254 predicted 459
6 SASI_Mm02_00314255 predicted 177
7 SASI_Mm02_00314256 predicted 102
8 SASI_Mm02_00314257 predicted 232
9 SASI_Mm02_00314258 predicted 265
10 SASI_Mm02_00314259 predicted 452
11 SASI_Mm01_00138013 predicted 757
12 SASI_Mm01_00138014 predicted 656
13 SASI_Mm01_00138015 predicted 924
14 SASI_Mm01_00138016 predicted 960
15 SASI_Mm01_00138017 predicted 719
16 SASI_Mm01_00138018 predicted 881
17 SASI_Mm01_00138019 predicted 756
18 SASI_Mm01_00138020 predicted 870
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008599
CXCL9 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 9
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008599.4-86s21c1
Sequence:CCGGCATCATCTTCCTGGAGCAGTGCTCGAGCACTGCTCCAGGAAGATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008599.4-276s21c1
Sequence:CCGGCTAGATCCGGACTCGGCAAATCTCGAGATTTGCCGAGTCCGGATCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008599.4-456s21c1
Sequence:CCGGACAAGCACCCTGAATCTTAATCTCGAGATTAAGATTCAGGGTGCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008599.4-681s21c1
Sequence:CCGGCCTTGAGCCTAGTCGTGATAACTCGAGTTATCACGACTAGGCTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008599.1-284s1c1
Sequence:CCGGGCTACACTGAAGAACGGAGATCTCGAGATCTCCGTTCTTCAGTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008599.1-211s1c1
Sequence:CCGGGATCCACTACAAATCCCTCAACTCGAGTTGAGGGATTTGTAGTGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008599.1-1075s1c1
Sequence:CCGGCCATCTTCAGAGCTTATTCTACTCGAGTAGAATAAGCTCTGAAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008599.1-450s1c1
Sequence:CCGGGTCGTCGTTCAAGGAAGACTACTCGAGTAGTCTTCCTTGAACGACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008599.1-342s1c1
Sequence:CCGGAGCTGATGAAAGAATGGGAAACTCGAGTTTCCCATTCTTTCATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008599
CXCL9 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 9
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008599.4-86s21c1
Sequence:CCGGCATCATCTTCCTGGAGCAGTGCTCGAGCACTGCTCCAGGAAGATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008599.4-276s21c1
Sequence:CCGGCTAGATCCGGACTCGGCAAATCTCGAGATTTGCCGAGTCCGGATCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008599.4-456s21c1
Sequence:CCGGACAAGCACCCTGAATCTTAATCTCGAGATTAAGATTCAGGGTGCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008599.4-681s21c1
Sequence:CCGGCCTTGAGCCTAGTCGTGATAACTCGAGTTATCACGACTAGGCTCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008599.1-284s1c1
Sequence:CCGGGCTACACTGAAGAACGGAGATCTCGAGATCTCCGTTCTTCAGTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008599.1-211s1c1
Sequence:CCGGGATCCACTACAAATCCCTCAACTCGAGTTGAGGGATTTGTAGTGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008599.1-1075s1c1
Sequence:CCGGCCATCTTCAGAGCTTATTCTACTCGAGTAGAATAAGCTCTGAAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008599.1-450s1c1
Sequence:CCGGGTCGTCGTTCAAGGAAGACTACTCGAGTAGTCTTCCTTGAACGACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008599.1-342s1c1
Sequence:CCGGAGCTGATGAAAGAATGGGAAACTCGAGTTTCCCATTCTTTCATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008599
CXCL9 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 9
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008599.4-86s21c1
Sequence:CCGGCATCATCTTCCTGGAGCAGTGCTCGAGCACTGCTCCAGGAAGATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008599.4-276s21c1
Sequence:CCGGCTAGATCCGGACTCGGCAAATCTCGAGATTTGCCGAGTCCGGATCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008599.4-456s21c1
Sequence:CCGGACAAGCACCCTGAATCTTAATCTCGAGATTAAGATTCAGGGTGCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008599.4-681s21c1
Sequence:CCGGCCTTGAGCCTAGTCGTGATAACTCGAGTTATCACGACTAGGCTCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008599.1-284s1c1
Sequence:CCGGGCTACACTGAAGAACGGAGATCTCGAGATCTCCGTTCTTCAGTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008599.1-211s1c1
Sequence:CCGGGATCCACTACAAATCCCTCAACTCGAGTTGAGGGATTTGTAGTGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067293    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008599.1-1075s1c1
Sequence:CCGGCCATCTTCAGAGCTTATTCTACTCGAGTAGAATAAGCTCTGAAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008599.1-450s1c1
Sequence:CCGGGTCGTCGTTCAAGGAAGACTACTCGAGTAGTCTTCCTTGAACGACGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008599.1-342s1c1
Sequence:CCGGAGCTGATGAAAGAATGGGAAACTCGAGTTTCCCATTCTTTCATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002416
CXCL9 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) ligand 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002416.1-483s21c1
Sequence:CCGGCCAAAGGAGGATGGCATATAACTCGAGTTATATGCCATCCTCCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002416.1-417s21c1
Sequence:CCGGAGAGACCACTTCACCAATAAGCTCGAGCTTATTGGTGAAGTGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002416.1-587s21c1
Sequence:CCGGCCAAACGTTAAGAATTGTTAACTCGAGTTAACAATTCTTAACGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002416.1-1408s1c1
Sequence:CCGGCCACAGTATATTTCCCTGTTTCTCGAGAAACAGGGAAATATACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002416.1-280s1c1
Sequence:CCGGGATGTGAAGGAACTGATTAAACTCGAGTTTAATCAGTTCCTTCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002416.1-82s1c1
Sequence:CCGGCTGGTTCTGATTGGAGTGCAACTCGAGTTGCACTCCAATCAGAACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002416.1-232s1c1
Sequence:CCGGGCTACACTGAAGAATGGAGTTCTCGAGAACTCCATTCTTCAGTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002416.1-169s1c1
Sequence:CCGGCAATCCTTGAAAGACCTTAAACTCGAGTTTAAGGTCTTTCAAGGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002416
CXCL9 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) ligand 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002416.1-483s21c1
Sequence:CCGGCCAAAGGAGGATGGCATATAACTCGAGTTATATGCCATCCTCCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002416.1-417s21c1
Sequence:CCGGAGAGACCACTTCACCAATAAGCTCGAGCTTATTGGTGAAGTGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000372026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002416.1-587s21c1
Sequence:CCGGCCAAACGTTAAGAATTGTTAACTCGAGTTAACAATTCTTAACGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002416.1-1408s1c1
Sequence:CCGGCCACAGTATATTTCCCTGTTTCTCGAGAAACAGGGAAATATACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002416.1-280s1c1
Sequence:CCGGGATGTGAAGGAACTGATTAAACTCGAGTTTAATCAGTTCCTTCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002416.1-82s1c1
Sequence:CCGGCTGGTTCTGATTGGAGTGCAACTCGAGTTGCACTCCAATCAGAACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002416.1-232s1c1
Sequence:CCGGGCTACACTGAAGAATGGAGTTCTCGAGAACTCCATTCTTCAGTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002416.1-169s1c1
Sequence:CCGGCAATCCTTGAAAGACCTTAAACTCGAGTTTAAGGTCTTTCAAGGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002416
CXCL9 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) ligand 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372075    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002416.1-483s21c1
Sequence:CCGGCCAAAGGAGGATGGCATATAACTCGAGTTATATGCCATCCTCCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002416.1-417s21c1
Sequence:CCGGAGAGACCACTTCACCAATAAGCTCGAGCTTATTGGTGAAGTGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000372026    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002416.1-587s21c1
Sequence:CCGGCCAAACGTTAAGAATTGTTAACTCGAGTTAACAATTCTTAACGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002416.1-1408s1c1
Sequence:CCGGCCACAGTATATTTCCCTGTTTCTCGAGAAACAGGGAAATATACTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002416.1-280s1c1
Sequence:CCGGGATGTGAAGGAACTGATTAAACTCGAGTTTAATCAGTTCCTTCACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002416.1-82s1c1
Sequence:CCGGCTGGTTCTGATTGGAGTGCAACTCGAGTTGCACTCCAATCAGAACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002416.1-232s1c1
Sequence:CCGGGCTACACTGAAGAATGGAGTTCTCGAGAACTCCATTCTTCAGTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002416.1-169s1c1
Sequence:CCGGCAATCCTTGAAAGACCTTAAACTCGAGTTTAAGGTCTTTCAAGGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)