EMAIL THIS PAGE TO A FRIEND

CXCR1

chemokine (C-X-C motif) receptor 1

67 Gene Product Result for
Synonyms: C-C C-C-CKR-1 CD128 CD181 CDw128a CKR-1 CMKAR1 IL8R1 IL8RA IL8RBA
Gene ID:
Human(3577) Summary: The protein encoded by this gene is a member of the G-protein-coupled receptor family. This protein is a receptor for interleukin 8 (IL8). It binds to IL8 with high affinity, and transduces the signal through a G-protein activated second messenger system. Knockout studies in mice suggested that this protein inhibits embryonic oligodendrocyte precursor migration in developing spinal cord. This gene, IL8RB, a gene encoding another high affinity IL8 receptor, as well as IL8RBP, a pseudogene of IL8RB, form a gene cluster in a region mapped to chromosome 2q33-q36. [provided by RefSeq, Jul 2008]
Mouse(227288) chemokine (C-X-C motif) receptor 1
Rat(54258) chemokine (C-X-C motif) receptor 1
Domestic Rabbit(100328622) chemokine (C-X-C motif) receptor 1
domestic guinea pig(100379619) chemokine (C-X-C motif) receptor 1
naked mole-rat(101712235) chemokine (C-X-C motif) receptor 1
cow(100125580) chemokine (C-X-C motif) receptor 1
dog(478906) chemokine (C-X-C motif) receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000634 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000634 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000634 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178241 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178241 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178241 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111061 MISSION® esiRNA esiRNA human IL8RA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000634 Rosetta Predictions human pricing
NM_019310 Rosetta Predictions rat pricing
NM_178241 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000634 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211891 predicted 216
2 SASI_Hs01_00211892 predicted 1130
3 SASI_Hs02_00302984 predicted 1098
4 SASI_Hs01_00211893 predicted 559
5 SASI_Hs01_00211894 predicted 1470
6 SASI_Hs01_00211895 predicted 1433
7 SASI_Hs01_00211896 predicted 1226
8 SASI_Hs01_00211897 predicted 1174
9 SASI_Hs01_00211898 predicted 1410
10 SASI_Hs01_00211899 predicted 739
11 SASI_Hs01_00211900 predicted 751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019310 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262275 predicted 792
2 SASI_Rn01_00102045 predicted 535
3 SASI_Rn01_00102046 predicted 810
4 SASI_Rn01_00102047 predicted 462
5 SASI_Rn01_00102048 predicted 366
6 SASI_Rn01_00102049 predicted 454
7 SASI_Rn01_00102050 predicted 616
8 SASI_Rn01_00102051 predicted 567
9 SASI_Rn01_00102053 predicted 776
10 SASI_Rn02_00262276 predicted 336
11 SASI_Rn01_00102052 predicted 597
12 SASI_Rn01_00102054 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178241 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070433 predicted 862
2 SASI_Mm01_00070434 predicted 499
3 SASI_Mm01_00070435 predicted 609
4 SASI_Mm01_00070436 predicted 622
5 SASI_Mm01_00070437 predicted 575
6 SASI_Mm01_00070438 predicted 859
7 SASI_Mm01_00070439 predicted 796
8 SASI_Mm02_00348634 predicted 871
9 SASI_Mm01_00070442 predicted 266
10 SASI_Mm02_00348635 predicted 576
11 SASI_Mm01_00070440 predicted 638
12 SASI_Mm01_00070441 predicted 633
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000634
CXCR1 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) receptor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000009131    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000634.2-1419s1c1
Sequence:CCGGCGTCACATCTTTAACCCACTACTCGAGTAGTGGGTTAAAGATGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000634.2-689s1c1
Sequence:CCGGCCTGGGAAATGACACAGCAAACTCGAGTTTGCTGTGTCATTTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000634.2-1145s1c1
Sequence:CCGGGTCTGTCAATGTCTCTTCCAACTCGAGTTGGAAGAGACATTGACAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000634.2-222s1c1
Sequence:CCGGGAGACACTCAACAAGTATGTTCTCGAGAACATACTTGTTGAGTGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000634.2-984s1c1
Sequence:CCGGGCCACTGAGATTCTGGGATTTCTCGAGAAATCCCAGAATCTCAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000634.2-1432s21c1
Sequence:CCGGACCCACTAACTGGCTAATTAGCTCGAGCTAATTAGCCAGTTAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000634.2-1109s21c1
Sequence:CCGGCTTGGCACGTCATCGTGTTACCTCGAGGTAACACGATGACGTGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000634.2-565s21c1
Sequence:CCGGAGCGTCACTTGGTCAAGTTTGCTCGAGCAAACTTGACCAAGTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000634
CXCR1 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) receptor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000009131    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000634.2-1419s1c1
Sequence:CCGGCGTCACATCTTTAACCCACTACTCGAGTAGTGGGTTAAAGATGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000634.2-689s1c1
Sequence:CCGGCCTGGGAAATGACACAGCAAACTCGAGTTTGCTGTGTCATTTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000634.2-1145s1c1
Sequence:CCGGGTCTGTCAATGTCTCTTCCAACTCGAGTTGGAAGAGACATTGACAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000634.2-222s1c1
Sequence:CCGGGAGACACTCAACAAGTATGTTCTCGAGAACATACTTGTTGAGTGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000634.2-984s1c1
Sequence:CCGGGCCACTGAGATTCTGGGATTTCTCGAGAAATCCCAGAATCTCAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000634.2-1432s21c1
Sequence:CCGGACCCACTAACTGGCTAATTAGCTCGAGCTAATTAGCCAGTTAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000634.2-1109s21c1
Sequence:CCGGCTTGGCACGTCATCGTGTTACCTCGAGGTAACACGATGACGTGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000634.2-565s21c1
Sequence:CCGGAGCGTCACTTGGTCAAGTTTGCTCGAGCAAACTTGACCAAGTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000634
CXCR1 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) receptor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000009131    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000634.2-1419s1c1
Sequence:CCGGCGTCACATCTTTAACCCACTACTCGAGTAGTGGGTTAAAGATGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000634.2-689s1c1
Sequence:CCGGCCTGGGAAATGACACAGCAAACTCGAGTTTGCTGTGTCATTTCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000634.2-1145s1c1
Sequence:CCGGGTCTGTCAATGTCTCTTCCAACTCGAGTTGGAAGAGACATTGACAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000634.2-222s1c1
Sequence:CCGGGAGACACTCAACAAGTATGTTCTCGAGAACATACTTGTTGAGTGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000634.2-984s1c1
Sequence:CCGGGCCACTGAGATTCTGGGATTTCTCGAGAAATCCCAGAATCTCAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000634.2-1432s21c1
Sequence:CCGGACCCACTAACTGGCTAATTAGCTCGAGCTAATTAGCCAGTTAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000634.2-1109s21c1
Sequence:CCGGCTTGGCACGTCATCGTGTTACCTCGAGGTAACACGATGACGTGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000634.2-565s21c1
Sequence:CCGGAGCGTCACTTGGTCAAGTTTGCTCGAGCAAACTTGACCAAGTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178241
CXCR1 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) receptor 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178241.1-104s1c1
Sequence:CCGGCCTGTAAGAGAGTTCCAATAACTCGAGTTATTGGAACTCTCTTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178241.1-78s1c1
Sequence:CCGGGCTGCCCACTGGAGATTATTTCTCGAGAAATAATCTCCAGTGGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178241.1-537s1c1
Sequence:CCGGCCGCCAGGCATATAAACCATTCTCGAGAATGGTTTATATGCCTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178241.1-696s1c1
Sequence:CCGGCATGCTCTTTAAGACCCACATCTCGAGATGTGGGTCTTAAAGAGCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178241.1-824s1c1
Sequence:CCGGCCCACTTGATTGAAGATACTTCTCGAGAAGTATCTTCAATCAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178241.4-909s21c1
Sequence:CCGGCATTGACCAGGCCCTGTATATCTCGAGATATACAGGGCCTGGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178241.4-506s21c1
Sequence:CCGGGAAAGCGCTACTTGGTTAAATCTCGAGATTTAACCAAGTAGCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178241.4-235s21c1
Sequence:CCGGTCGCTGGTGATGCTGGTTATCCTCGAGGATAACCAGCATCACCAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178241.4-76s21c1
Sequence:CCGGACTAATCCTGAGGGTGACTTTCTCGAGAAAGTCACCCTCAGGATTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178241
CXCR1 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) receptor 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178241.1-104s1c1
Sequence:CCGGCCTGTAAGAGAGTTCCAATAACTCGAGTTATTGGAACTCTCTTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178241.1-78s1c1
Sequence:CCGGGCTGCCCACTGGAGATTATTTCTCGAGAAATAATCTCCAGTGGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178241.1-537s1c1
Sequence:CCGGCCGCCAGGCATATAAACCATTCTCGAGAATGGTTTATATGCCTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178241.1-696s1c1
Sequence:CCGGCATGCTCTTTAAGACCCACATCTCGAGATGTGGGTCTTAAAGAGCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178241.1-824s1c1
Sequence:CCGGCCCACTTGATTGAAGATACTTCTCGAGAAGTATCTTCAATCAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178241.4-909s21c1
Sequence:CCGGCATTGACCAGGCCCTGTATATCTCGAGATATACAGGGCCTGGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178241.4-506s21c1
Sequence:CCGGGAAAGCGCTACTTGGTTAAATCTCGAGATTTAACCAAGTAGCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178241.4-235s21c1
Sequence:CCGGTCGCTGGTGATGCTGGTTATCCTCGAGGATAACCAGCATCACCAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178241.4-76s21c1
Sequence:CCGGACTAATCCTGAGGGTGACTTTCTCGAGAAAGTCACCCTCAGGATTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178241
CXCR1 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) receptor 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178241.1-104s1c1
Sequence:CCGGCCTGTAAGAGAGTTCCAATAACTCGAGTTATTGGAACTCTCTTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178241.1-78s1c1
Sequence:CCGGGCTGCCCACTGGAGATTATTTCTCGAGAAATAATCTCCAGTGGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178241.1-537s1c1
Sequence:CCGGCCGCCAGGCATATAAACCATTCTCGAGAATGGTTTATATGCCTGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178241.1-696s1c1
Sequence:CCGGCATGCTCTTTAAGACCCACATCTCGAGATGTGGGTCTTAAAGAGCATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178241.1-824s1c1
Sequence:CCGGCCCACTTGATTGAAGATACTTCTCGAGAAGTATCTTCAATCAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178241.4-909s21c1
Sequence:CCGGCATTGACCAGGCCCTGTATATCTCGAGATATACAGGGCCTGGTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178241.4-506s21c1
Sequence:CCGGGAAAGCGCTACTTGGTTAAATCTCGAGATTTAACCAAGTAGCGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178241.4-235s21c1
Sequence:CCGGTCGCTGGTGATGCTGGTTATCCTCGAGGATAACCAGCATCACCAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178241.4-76s21c1
Sequence:CCGGACTAATCCTGAGGGTGACTTTCTCGAGAAAGTCACCCTCAGGATTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks