EMAIL THIS PAGE TO A FRIEND

CXCR2

chemokine (C-X-C motif) receptor 2

64 Gene Product Result for
Synonyms: CD182 CDw128b CMKAR2 IL8R2 IL8RA IL8RB
UniProtKB ID: P25025, Q8IUZ1, Q9P2T6, Q9P2T7
Gene ID:
Human(3579) Summary: The protein encoded by this gene is a member of the G-protein-coupled receptor family. This protein is a receptor for interleukin 8 (IL8). It binds to IL8 with high affinity, and transduces the signal through a G-protein activated second messenger system. This receptor also binds to chemokine (C-X-C motif) ligand 1 (CXCL1/MGSA), a protein with melanoma growth stimulating activity, and has been shown to be a major component required for serum-dependent melanoma cell growth. This receptor mediates neutrophil migration to sites of inflammation. The angiogenic effects of IL8 in intestinal microvascular endothelial cells are found to be mediated by this receptor. Knockout studies in mice suggested that this receptor controls the positioning of oligodendrocyte precursors in developing spinal cord by arresting their migration. This gene, IL8RA, a gene encoding another high affinity IL8 receptor, as well as IL8RBP, a pseudogene of IL8RB, form a gene cluster in a region mapped to chromosome 2q33-q36. Alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2009]
Mouse(12765) chemokine (C-X-C motif) receptor 2
Rat(29385) chemokine (C-X-C motif) receptor 2
chicken(430652) chemokine (C-X-C motif) receptor 2
cow(281863) interleukin 8 receptor, beta
cow(782719) chemokine (C-X-C motif) receptor 2
domestic cat(101085396) chemokine (C-X-C motif) receptor 2
dog(478905) interleukin 8 receptor, beta
naked mole-rat(101712581) chemokine (C-X-C motif) receptor 2
domestic guinea pig(100379569) chemokine (C-X-C motif) receptor 2
sheep(101110214) chemokine (C-X-C motif) receptor 2
Domestic Rabbit(100328627) chemokine (C-X-C motif) receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2502034 Anti-Cxcr2 (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse
ELISA, western blot pricing
SAB1406027 Anti-CXCR2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2900183 Anti-CXCR2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
HPA031999 Anti-CXCR2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA032017 Anti-CXCR2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4501544 Anti-IL-8R β, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence pricing
SAB2103792 Anti-IL8RB, (N-terminal) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504243 Anti-phospho-IL-8R β/CDw128 β (pSer347) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301547 Anti-phospho-IL-8R β/CDw128 β (pSer347) antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
C6348 Monoclonal Anti-CXCR2 (IL-8 RB) antibody produced in mouse clone 48311.211, purified immunoglobulin, lyophilized powder human
flow cytometry, neutralization pricing
SAB2702325 Monoclonal Anti-CXCR2 antibody produced in mouse clone GT547, affinity isolated antibody human
western blot pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
438502 5-Phenyl-1H-1,2,4-triazole-3-thiol 95% human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009909 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009909 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009909 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001557 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001557 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001557 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001557 Rosetta Predictions human pricing
NM_017183 Rosetta Predictions rat pricing
NM_009909 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011890 predicted 964
2 SASI_Hs01_00011891 predicted 1066
3 SASI_Hs01_00011892 predicted 1395
4 SASI_Hs01_00011893 predicted 1374
5 SASI_Hs01_00011895 predicted 873
6 SASI_Hs01_00011896 predicted 1260
7 SASI_Hs01_00011897 predicted 532
8 SASI_Hs02_00332125 predicted 865
9 SASI_Hs02_00332126 predicted 1382
10 SASI_Hs02_00332127 predicted 964
11 SASI_Hs01_00011888 predicted 1477
12 SASI_Hs01_00011889 predicted 996
13 SASI_Hs01_00011894 predicted 1026
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093323 predicted 658
2 SASI_Rn01_00093324 predicted 575
3 SASI_Rn01_00093325 predicted 696
4 SASI_Rn01_00093326 predicted 1075
5 SASI_Rn01_00093329 predicted 724
6 SASI_Rn01_00093330 predicted 403
7 SASI_Rn01_00093331 predicted 509
8 SASI_Rn01_00093332 predicted 632
9 SASI_Rn02_00261519 predicted 581
10 SASI_Rn02_00261520 predicted 694
11 SASI_Rn01_00093327 predicted 950
12 SASI_Rn01_00093328 predicted 668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009909 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186757 predicted 1113
2 SASI_Mm01_00186758 predicted 1095
3 SASI_Mm01_00186759 predicted 711
4 SASI_Mm01_00186760 predicted 575
5 SASI_Mm01_00186761 predicted 1201
6 SASI_Mm01_00186762 predicted 1218
7 SASI_Mm01_00186763 predicted 895
8 SASI_Mm01_00186765 predicted 1093
9 SASI_Mm01_00186766 predicted 490
10 SASI_Mm02_00317426 predicted 1203
11 SASI_Mm01_00186764 predicted 646
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009909
CXCR2 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) receptor 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009909.3-1207s21c1
Sequence:CCGGCACCTCTACTACCCTCTAAAGCTCGAGCTTTAGAGGGTAGTAGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009909.3-284s21c1
Sequence:CCGGAGTTATGCTGTGGTTGTAATACTCGAGTATTACAACCACAGCATAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009909.3-732s21c1
Sequence:CCGGATGAGGATGTAGGTAACAATACTCGAGTATTGTTACCTACATCCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009909.3-1143s21c1
Sequence:CCGGTTGTCAGCAAGGAGTTCTTAGCTCGAGCTAAGAACTCCTTGCTGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009909.2-1457s1c1
Sequence:CCGGCGTTACAATTACAGTGAGATACTCGAGTATCTCACTGTAATTGTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009909.2-998s1c1
Sequence:CCGGGCCTTGAATGCTACGGAGATTCTCGAGAATCTCCGTAGCATTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009909.2-152s1c1
Sequence:CCGGGAAGATTTCTTCAGTGGAGATCTCGAGATCTCCACTGAAGAAATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009909.2-466s1c1
Sequence:CCGGCCTGTGCAAGATATTCTCATACTCGAGTATGAGAATATCTTGCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009909
CXCR2 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) receptor 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009909.3-1207s21c1
Sequence:CCGGCACCTCTACTACCCTCTAAAGCTCGAGCTTTAGAGGGTAGTAGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009909.3-284s21c1
Sequence:CCGGAGTTATGCTGTGGTTGTAATACTCGAGTATTACAACCACAGCATAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009909.3-732s21c1
Sequence:CCGGATGAGGATGTAGGTAACAATACTCGAGTATTGTTACCTACATCCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009909.3-1143s21c1
Sequence:CCGGTTGTCAGCAAGGAGTTCTTAGCTCGAGCTAAGAACTCCTTGCTGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009909.2-1457s1c1
Sequence:CCGGCGTTACAATTACAGTGAGATACTCGAGTATCTCACTGTAATTGTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009909.2-998s1c1
Sequence:CCGGGCCTTGAATGCTACGGAGATTCTCGAGAATCTCCGTAGCATTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009909.2-152s1c1
Sequence:CCGGGAAGATTTCTTCAGTGGAGATCTCGAGATCTCCACTGAAGAAATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009909.2-466s1c1
Sequence:CCGGCCTGTGCAAGATATTCTCATACTCGAGTATGAGAATATCTTGCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009909
CXCR2 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) receptor 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009909.3-1207s21c1
Sequence:CCGGCACCTCTACTACCCTCTAAAGCTCGAGCTTTAGAGGGTAGTAGAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009909.3-284s21c1
Sequence:CCGGAGTTATGCTGTGGTTGTAATACTCGAGTATTACAACCACAGCATAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009909.3-732s21c1
Sequence:CCGGATGAGGATGTAGGTAACAATACTCGAGTATTGTTACCTACATCCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009909.3-1143s21c1
Sequence:CCGGTTGTCAGCAAGGAGTTCTTAGCTCGAGCTAAGAACTCCTTGCTGACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026647    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009909.2-1457s1c1
Sequence:CCGGCGTTACAATTACAGTGAGATACTCGAGTATCTCACTGTAATTGTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009909.2-998s1c1
Sequence:CCGGGCCTTGAATGCTACGGAGATTCTCGAGAATCTCCGTAGCATTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009909.2-152s1c1
Sequence:CCGGGAAGATTTCTTCAGTGGAGATCTCGAGATCTCCACTGAAGAAATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009909.2-466s1c1
Sequence:CCGGCCTGTGCAAGATATTCTCATACTCGAGTATGAGAATATCTTGCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001557
CXCR2 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) receptor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001557.2-1799s21c1
Sequence:CCGGCTCATTAGGATGGCTAGTATCCTCGAGGATACTAGCCATCCTAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001557.2-1382s21c1
Sequence:CCGGTCCTCAAGATTCTAGCTATACCTCGAGGTATAGCTAGAATCTTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001557.2-879s21c1
Sequence:CCGGGAAGCGCTACTTGGTCAAATTCTCGAGAATTTGACCAAGTAGCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009136    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001557.2-2652s1c1
Sequence:CCGGGCCACTAAATTGACACTTAAACTCGAGTTTAAGTGTCAATTTAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001557.2-536s1c1
Sequence:CCGGCCCTGGAAATCAACAAGTATTCTCGAGAATACTTGTTGATTTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001557.2-1470s1c1
Sequence:CCGGGCACACTTCCACTACTCTCTACTCGAGTAGAGAGTAGTGGAAGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001557.2-883s1c1
Sequence:CCGGCGCTACTTGGTCAAATTCATACTCGAGTATGAATTTGACCAAGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001557.2-965s1c1
Sequence:CCGGCCGTCTACTCATCCAATGTTACTCGAGTAACATTGGATGAGTAGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001557
CXCR2 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) receptor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001557.2-1799s21c1
Sequence:CCGGCTCATTAGGATGGCTAGTATCCTCGAGGATACTAGCCATCCTAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001557.2-1382s21c1
Sequence:CCGGTCCTCAAGATTCTAGCTATACCTCGAGGTATAGCTAGAATCTTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001557.2-879s21c1
Sequence:CCGGGAAGCGCTACTTGGTCAAATTCTCGAGAATTTGACCAAGTAGCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009136    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001557.2-2652s1c1
Sequence:CCGGGCCACTAAATTGACACTTAAACTCGAGTTTAAGTGTCAATTTAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001557.2-536s1c1
Sequence:CCGGCCCTGGAAATCAACAAGTATTCTCGAGAATACTTGTTGATTTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001557.2-1470s1c1
Sequence:CCGGGCACACTTCCACTACTCTCTACTCGAGTAGAGAGTAGTGGAAGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001557.2-883s1c1
Sequence:CCGGCGCTACTTGGTCAAATTCATACTCGAGTATGAATTTGACCAAGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001557.2-965s1c1
Sequence:CCGGCCGTCTACTCATCCAATGTTACTCGAGTAACATTGGATGAGTAGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001557
CXCR2 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) receptor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001557.2-1799s21c1
Sequence:CCGGCTCATTAGGATGGCTAGTATCCTCGAGGATACTAGCCATCCTAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001557.2-1382s21c1
Sequence:CCGGTCCTCAAGATTCTAGCTATACCTCGAGGTATAGCTAGAATCTTGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001557.2-879s21c1
Sequence:CCGGGAAGCGCTACTTGGTCAAATTCTCGAGAATTTGACCAAGTAGCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009136    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001557.2-2652s1c1
Sequence:CCGGGCCACTAAATTGACACTTAAACTCGAGTTTAAGTGTCAATTTAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001557.2-536s1c1
Sequence:CCGGCCCTGGAAATCAACAAGTATTCTCGAGAATACTTGTTGATTTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001557.2-1470s1c1
Sequence:CCGGGCACACTTCCACTACTCTCTACTCGAGTAGAGAGTAGTGGAAGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001557.2-883s1c1
Sequence:CCGGCGCTACTTGGTCAAATTCATACTCGAGTATGAATTTGACCAAGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001557.2-965s1c1
Sequence:CCGGCCGTCTACTCATCCAATGTTACTCGAGTAACATTGGATGAGTAGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks