EMAIL THIS PAGE TO A FRIEND

CXCR3

chemokine (C-X-C motif) receptor 3

61 Gene Product Result for
Synonyms: CD182 CD183 CKR-L2 CMKAR3 GPR9 IP10-R Mig-R MigR
UniProtKB ID: P49682, B2R982, O15185, Q7Z710, Q9P2T4, Q9P2T5
Gene ID:
Human(2833) Summary: This gene encodes a G protein-coupled receptor with selectivity for three chemokines, termed CXCL9/Mig (monokine induced by interferon-g), CXCL10/IP10 (interferon-g-inducible 10 kDa protein) and CXCL11/I-TAC (interferon-inducible T cell a-chemoattractant). Binding of chemokines to this protein induces cellular responses that are involved in leukocyte traffic, most notably integrin activation, cytoskeletal changes and chemotactic migration. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. One of the isoforms (CXCR3-B) shows high affinity binding to chemokine, CXCL4/PF4 (PMID:12782716). [provided by RefSeq, Jun 2011]
Mouse(12766) chemokine (C-X-C motif) receptor 3
Rat(84475) chemokine (C-X-C motif) receptor 3
dog(491952) chemokine (C-X-C motif) receptor 3
cow(497018) chemokine (C-X-C motif) receptor 3
domestic cat(101094573) chemokine (C-X-C motif) receptor 3
Goat(100860874) chemokine (C-X-C motif) receptor 3
sheep(101107671) chemokine (C-X-C motif) receptor 3
domestic guinea pig(100735932) chemokine (C-X-C motif) receptor 3
naked mole-rat(101722797) chemokine (C-X-C motif) receptor 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009910 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009910 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009910 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001504 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001504 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001504 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150831 MISSION® esiRNA esiRNA human CXCR3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001504 Rosetta Predictions human pricing
NM_053415 Rosetta Predictions rat pricing
NM_009910 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331994 predicted 996
2 SASI_Hs01_00077659 predicted 1119
3 SASI_Hs02_00331995 predicted 1341
4 SASI_Hs01_00077660 predicted 194
5 SASI_Hs01_00077661 predicted 931
6 SASI_Hs01_00077662 predicted 1336
7 SASI_Hs01_00077664 predicted 1149
8 SASI_Hs01_00077665 predicted 925
9 SASI_Hs01_00077666 predicted 916
10 SASI_Hs01_00077667 predicted 1330
11 SASI_Hs01_00077658 predicted 1129
12 SASI_Hs01_00077663 predicted 1301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053415 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265939 predicted 1351
2 SASI_Rn01_00063580 predicted 207
3 SASI_Rn01_00063582 predicted 1316
4 SASI_Rn01_00063584 predicted 1177
5 SASI_Rn01_00063585 predicted 437
6 SASI_Rn01_00063586 predicted 1229
7 SASI_Rn02_00265940 predicted 1369
8 SASI_Rn02_00265941 predicted 1390
9 SASI_Rn01_00063588 predicted 212
10 SASI_Rn01_00063589 predicted 210
11 SASI_Rn01_00063581 predicted 558
12 SASI_Rn01_00063583 predicted 324
13 SASI_Rn01_00063587 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009910 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029900 predicted 371
2 SASI_Mm01_00029901 predicted 776
3 SASI_Mm01_00029902 predicted 372
4 SASI_Mm01_00029903 predicted 508
5 SASI_Mm01_00029904 predicted 215
6 SASI_Mm01_00029905 predicted 470
7 SASI_Mm01_00029907 predicted 1271
8 SASI_Mm01_00029908 predicted 1143
9 SASI_Mm01_00029909 predicted 895
10 SASI_Mm02_00317427 predicted 625
11 SASI_Mm01_00029906 predicted 1188
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009910
CXCR3 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) receptor 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009910.1-1128s1c1
Sequence:CCGGCCGTCATCTTCACGGAGAGAACTCGAGTTCTCTCCGTGAAGATGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009910.1-229s1c1
Sequence:CCGGGCCTGAACTTTGACAGAACCTCTCGAGAGGTTCTGTCAAAGTTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009910.1-378s1c1
Sequence:CCGGGCCGATGTTCTGCTGGTGTTACTCGAGTAACACCAGCAGAACATCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009910.1-126s1c1
Sequence:CCGGGCCTCGGACTTTGCCTTTCTTCTCGAGAAGAAAGGCAAAGTCCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009910.1-946s1c1
Sequence:CCGGCCCGCAACTGTGGTCGAGAAACTCGAGTTTCTCGACCACAGTTGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009910
CXCR3 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) receptor 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009910.1-1128s1c1
Sequence:CCGGCCGTCATCTTCACGGAGAGAACTCGAGTTCTCTCCGTGAAGATGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009910.1-229s1c1
Sequence:CCGGGCCTGAACTTTGACAGAACCTCTCGAGAGGTTCTGTCAAAGTTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009910.1-378s1c1
Sequence:CCGGGCCGATGTTCTGCTGGTGTTACTCGAGTAACACCAGCAGAACATCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009910.1-126s1c1
Sequence:CCGGGCCTCGGACTTTGCCTTTCTTCTCGAGAAGAAAGGCAAAGTCCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009910.1-946s1c1
Sequence:CCGGCCCGCAACTGTGGTCGAGAAACTCGAGTTTCTCGACCACAGTTGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009910
CXCR3 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) receptor 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009910.1-1128s1c1
Sequence:CCGGCCGTCATCTTCACGGAGAGAACTCGAGTTCTCTCCGTGAAGATGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009910.1-229s1c1
Sequence:CCGGGCCTGAACTTTGACAGAACCTCTCGAGAGGTTCTGTCAAAGTTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009910.1-378s1c1
Sequence:CCGGGCCGATGTTCTGCTGGTGTTACTCGAGTAACACCAGCAGAACATCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009910.1-126s1c1
Sequence:CCGGGCCTCGGACTTTGCCTTTCTTCTCGAGAAGAAAGGCAAAGTCCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009910.1-946s1c1
Sequence:CCGGCCCGCAACTGTGGTCGAGAAACTCGAGTTTCTCGACCACAGTTGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001504
CXCR3 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) receptor 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001504.1-1413s1c1
Sequence:CCGGGCCCTTCTCATTTGGAAACTACTCGAGTAGTTTCCAAATGAGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001504.1-455s1c1
Sequence:CCGGCCTCTTCAACATCAACTTCTACTCGAGTAGAAGTTGATGTTGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001504.1-141s1c1
Sequence:CCGGTCTTCCTATGACTATGGAGAACTCGAGTTCTCCATAGTCATAGGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001504.1-1011s1c1
Sequence:CCGGCCGCTGCTCTATGCCTTTGTACTCGAGTACAAAGGCATAGAGCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001504.1-513s1c1
Sequence:CCGGCGCTACCTGAACATAGTTCATCTCGAGATGAACTATGTTCAGGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001504.1-1127s21c1
Sequence:CCGGGGATTCATCCTGGTCTGAGACCTCGAGGTCTCAGACCAGGATGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001504.1-1459s21c1
Sequence:CCGGGAGTACAAGGCATGGCGTAGACTCGAGTCTACGCCATGCCTTGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001504.1-1012s21c1
Sequence:CCGGCGCTGCTCTATGCCTTTGTAGCTCGAGCTACAAAGGCATAGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001504.1-1415s21c1
Sequence:CCGGCCTTCTCATTTGGAAACTAAACTCGAGTTTAGTTTCCAAATGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001504
CXCR3 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) receptor 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001504.1-1413s1c1
Sequence:CCGGGCCCTTCTCATTTGGAAACTACTCGAGTAGTTTCCAAATGAGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001504.1-455s1c1
Sequence:CCGGCCTCTTCAACATCAACTTCTACTCGAGTAGAAGTTGATGTTGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001504.1-141s1c1
Sequence:CCGGTCTTCCTATGACTATGGAGAACTCGAGTTCTCCATAGTCATAGGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001504.1-1011s1c1
Sequence:CCGGCCGCTGCTCTATGCCTTTGTACTCGAGTACAAAGGCATAGAGCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001504.1-513s1c1
Sequence:CCGGCGCTACCTGAACATAGTTCATCTCGAGATGAACTATGTTCAGGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001504.1-1127s21c1
Sequence:CCGGGGATTCATCCTGGTCTGAGACCTCGAGGTCTCAGACCAGGATGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001504.1-1459s21c1
Sequence:CCGGGAGTACAAGGCATGGCGTAGACTCGAGTCTACGCCATGCCTTGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001504.1-1012s21c1
Sequence:CCGGCGCTGCTCTATGCCTTTGTAGCTCGAGCTACAAAGGCATAGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001504.1-1415s21c1
Sequence:CCGGCCTTCTCATTTGGAAACTAAACTCGAGTTTAGTTTCCAAATGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001504
CXCR3 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) receptor 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011314    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001504.1-1413s1c1
Sequence:CCGGGCCCTTCTCATTTGGAAACTACTCGAGTAGTTTCCAAATGAGAAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001504.1-455s1c1
Sequence:CCGGCCTCTTCAACATCAACTTCTACTCGAGTAGAAGTTGATGTTGAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001504.1-141s1c1
Sequence:CCGGTCTTCCTATGACTATGGAGAACTCGAGTTCTCCATAGTCATAGGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001504.1-1011s1c1
Sequence:CCGGCCGCTGCTCTATGCCTTTGTACTCGAGTACAAAGGCATAGAGCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001504.1-513s1c1
Sequence:CCGGCGCTACCTGAACATAGTTCATCTCGAGATGAACTATGTTCAGGTAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356925    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001504.1-1127s21c1
Sequence:CCGGGGATTCATCCTGGTCTGAGACCTCGAGGTCTCAGACCAGGATGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001504.1-1459s21c1
Sequence:CCGGGAGTACAAGGCATGGCGTAGACTCGAGTCTACGCCATGCCTTGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001504.1-1012s21c1
Sequence:CCGGCGCTGCTCTATGCCTTTGTAGCTCGAGCTACAAAGGCATAGAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356865    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001504.1-1415s21c1
Sequence:CCGGCCTTCTCATTTGGAAACTAAACTCGAGTTTAGTTTCCAAATGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks