EMAIL THIS PAGE TO A FRIEND

CXCR4

chemokine (C-X-C motif) receptor 4

128 Gene Product Result for
Synonyms: CD184 D2S201E FB22 HM89 HSY3RR LAP3 LCR1 LESTR NPY3R NPYR NPYRL NPYY3R WHIM
Gene ID:
Human(7852) Summary: This gene encodes a CXC chemokine receptor specific for stromal cell-derived factor-1. The protein has 7 transmembrane regions and is located on the cell surface. It acts with the CD4 protein to support HIV entry into cells and is also highly expressed in breast cancer cells. Mutations in this gene have been associated with WHIM (warts, hypogammaglobulinemia, infections, and myelokathexis) syndrome. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(12767) chemokine (C-X-C motif) receptor 4
Rat(60628) chemokine (C-X-C motif) receptor 4
chicken(395324) chemokine (C-X-C motif) receptor 4
domestic cat(493676) chemokine (C-X-C motif) receptor 4
dog(483900) chemokine (C-X-C motif) receptor 4
cow(281736) chemokine (C-X-C motif) receptor 4
naked mole-rat(101699254) chemokine (C-X-C motif) receptor 4
domestic guinea pig(100731341) chemokine (C-X-C motif) receptor 4
sheep(443532) neuropeptide Y receptor type 3
Domestic Rabbit(100346189) chemokine (C-X-C motif) receptor 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C8352 Anti-CXCR4 (Fusin) (182-196) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
C8227 Anti-CXCR4 (Fusin), N-Terminal antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
GW21075 Anti-CXCR4 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
western blot pricing
C3116 Anti-CXCR4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB3500383 Anti-CXCR4 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
ELISA, flow cytometry, immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
SAB4504153 Anti-phospho-CXCR4 (pSer339) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
C6598 Monoclonal Anti-CXCR4 (Fusin) antibody produced in mouse clone 44716, purified immunoglobulin, lyophilized powder human, feline
flow cytometry, immunohistochemistry, neutralization pricing
WH0007852M2 Monoclonal Anti-CXCR4 antibody produced in mouse clone 1F8, ascites fluid, buffered aqueous solution human
ELISA, western blot pricing
SAB1404560 Monoclonal Anti-CXCR4, (N-terminal) antibody produced in mouse clone 2G9, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003467 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003467 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003467 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009911 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009911 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009911 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008540 Rosetta Predictions human pricing
NM_003467 siRNAs that have been validated in the lab human pricing
NM_022205 Rosetta Predictions rat pricing
NM_009911 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008540 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219072 predicted 996
2 SASI_Hs01_00219075 predicted 1100
3 SASI_Hs01_00219076 predicted 856
4 SASI_Hs01_00219078 predicted 824
5 SASI_Hs01_00219079 predicted 929
6 SASI_Hs01_00219080 predicted 1120
7 SASI_Hs02_00305498 predicted 680
8 SASI_Hs01_00219081 predicted 650
9 SASI_Hs02_00305499 predicted 590
10 SASI_Hs02_00305500 predicted 1018
11 SASI_Hs01_00219073 predicted 961
12 SASI_Hs01_00219074 predicted 848
13 SASI_Hs01_00219077 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003467 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084885 validated 740
1 SASI_Hs01_00084886 validated 628
2 SASI_Hs01_00084884 predicted 770
3 SASI_Hs01_00084887 predicted 879
4 SASI_Hs01_00084888 predicted 639
5 SASI_Hs01_00084890 predicted 601
6 SASI_Hs01_00084891 predicted 705
7 SASI_Hs01_00084892 predicted 895
8 SASI_Hs02_00335721 predicted 458
9 SASI_Hs01_00084893 predicted 425
10 SASI_Hs02_00335722 predicted 377
11 SASI_Hs02_00335723 predicted 802
12 SASI_Hs01_00084889 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022205 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043604 predicted 382
2 SASI_Rn01_00043605 predicted 747
3 SASI_Rn01_00043606 predicted 394
4 SASI_Rn01_00043607 predicted 345
5 SASI_Rn01_00043608 predicted 527
6 SASI_Rn01_00043609 predicted 897
7 SASI_Rn01_00043610 predicted 672
8 SASI_Rn02_00262960 predicted 708
9 SASI_Rn02_00262961 predicted 794
10 SASI_Rn01_00043612 predicted 409
11 SASI_Rn01_00043611 predicted 656
12 SASI_Rn01_00043613 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009911 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317428 predicted 271
2 SASI_Mm01_00029800 predicted 747
3 SASI_Mm02_00317429 predicted 463
4 SASI_Mm01_00029801 predicted 427
5 SASI_Mm01_00029802 predicted 751
6 SASI_Mm01_00029803 predicted 555
7 SASI_Mm01_00029805 predicted 372
8 SASI_Mm01_00029806 predicted 827
9 SASI_Mm01_00029807 predicted 294
10 SASI_Mm02_00317430 predicted 235
11 SASI_Mm01_00029804 predicted 752
12 SASI_Mm01_00029808 predicted 285
13 SASI_Mm01_00029809 predicted 762
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003467
VALIDATED
CXCR4 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) receptor 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000355715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003467.2-1429s21c1
Sequence:CCGGGCGTGTAGTGAATCACGTAAACTCGAGTTTACGTGATTCACTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003467.2-739s21c1
Sequence:CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003467.2-1512s21c1
Sequence:CCGGCCTGTTCTTAAGACGTGATTTCTCGAGAAATCACGTCTTAAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003467.2-122s21c1
Sequence:CCGGAGATAACTACACCGAGGAAATCTCGAGATTTCCTCGGTGTAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000355689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003467.2-1146s21c1
Sequence:CCGGTCCAGCTAACACAGATGTAAACTCGAGTTTACATCTGTGTTAGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003467.2-598s21c1
Sequence:CCGGCTATTCCCGACTTCATCTTTGCTCGAGCAAAGATGAAGTCGGGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003467.2-388s21c1
Sequence:CCGGCCGTGGCAAACTGGTACTTTGCTCGAGCAAAGTACCAGTTTGCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003467.x-844s1c1
Sequence:CCGGGCTGCCTTACTACATTGGGATCTCGAGATCCCAATGTAGTAAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003467.x-226s1c1
Sequence:CCGGCATCATCTTCTTAACTGGCATCTCGAGATGCCAGTTAAGAAGATGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003467.x-346s1c1
Sequence:CCGGCTTTGTCATCACGCTTCCCTTCTCGAGAAGGGAAGCGTGATGACAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003467.x-1431s1c1
Sequence:CCGGGAATCACGTAAAGCTAGAAATCTCGAGATTTCTAGCTTTACGTGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003467.x-295s1c1
Sequence:CCGGGAGAAGCATGACGGACAAGTACTCGAGTACTTGTCCGTCATGCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003467
VALIDATED
CXCR4 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) receptor 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000355715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003467.2-1429s21c1
Sequence:CCGGGCGTGTAGTGAATCACGTAAACTCGAGTTTACGTGATTCACTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003467.2-739s21c1
Sequence:CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003467.2-1512s21c1
Sequence:CCGGCCTGTTCTTAAGACGTGATTTCTCGAGAAATCACGTCTTAAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003467.2-122s21c1
Sequence:CCGGAGATAACTACACCGAGGAAATCTCGAGATTTCCTCGGTGTAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000355689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003467.2-1146s21c1
Sequence:CCGGTCCAGCTAACACAGATGTAAACTCGAGTTTACATCTGTGTTAGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003467.2-598s21c1
Sequence:CCGGCTATTCCCGACTTCATCTTTGCTCGAGCAAAGATGAAGTCGGGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003467.2-388s21c1
Sequence:CCGGCCGTGGCAAACTGGTACTTTGCTCGAGCAAAGTACCAGTTTGCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003467.x-844s1c1
Sequence:CCGGGCTGCCTTACTACATTGGGATCTCGAGATCCCAATGTAGTAAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003467.x-226s1c1
Sequence:CCGGCATCATCTTCTTAACTGGCATCTCGAGATGCCAGTTAAGAAGATGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003467.x-346s1c1
Sequence:CCGGCTTTGTCATCACGCTTCCCTTCTCGAGAAGGGAAGCGTGATGACAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003467.x-1431s1c1
Sequence:CCGGGAATCACGTAAAGCTAGAAATCTCGAGATTTCTAGCTTTACGTGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003467.x-295s1c1
Sequence:CCGGGAGAAGCATGACGGACAAGTACTCGAGTACTTGTCCGTCATGCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003467
VALIDATED
CXCR4 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) receptor 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000355715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003467.2-1429s21c1
Sequence:CCGGGCGTGTAGTGAATCACGTAAACTCGAGTTTACGTGATTCACTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003467.2-739s21c1
Sequence:CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256865    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003467.2-1512s21c1
Sequence:CCGGCCTGTTCTTAAGACGTGATTTCTCGAGAAATCACGTCTTAAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003467.2-122s21c1
Sequence:CCGGAGATAACTACACCGAGGAAATCTCGAGATTTCCTCGGTGTAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000355689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003467.2-1146s21c1
Sequence:CCGGTCCAGCTAACACAGATGTAAACTCGAGTTTACATCTGTGTTAGCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003467.2-598s21c1
Sequence:CCGGCTATTCCCGACTTCATCTTTGCTCGAGCAAAGATGAAGTCGGGAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003467.2-388s21c1
Sequence:CCGGCCGTGGCAAACTGGTACTTTGCTCGAGCAAAGTACCAGTTTGCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003467.x-844s1c1
Sequence:CCGGGCTGCCTTACTACATTGGGATCTCGAGATCCCAATGTAGTAAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003467.x-226s1c1
Sequence:CCGGCATCATCTTCTTAACTGGCATCTCGAGATGCCAGTTAAGAAGATGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003467.x-346s1c1
Sequence:CCGGCTTTGTCATCACGCTTCCCTTCTCGAGAAGGGAAGCGTGATGACAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004056    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003467.x-1431s1c1
Sequence:CCGGGAATCACGTAAAGCTAGAAATCTCGAGATTTCTAGCTTTACGTGATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003467.x-295s1c1
Sequence:CCGGGAGAAGCATGACGGACAAGTACTCGAGTACTTGTCCGTCATGCTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009911
CXCR4 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) receptor 4
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009911.3-1171s21c1
Sequence:CCGGCACTTATGCAAAGACATATATCTCGAGATATATGTCTTTGCATAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009911.2-1118s1c1
Sequence:CCGGCAAGATCCTTTCCAAAGGAAACTCGAGTTTCCTTTGGAAAGGATCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009911.2-147s1c1
Sequence:CCGGACTTCTGATAACTACTCTGAACTCGAGTTCAGAGTAGTTATCAGAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009911.2-623s1c1
Sequence:CCGGCCTGACTATACCTGACTTCATCTCGAGATGAAGTCAGGTATAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009911.2-461s1c1
Sequence:CCGGCCATATCATCTACACTGTCAACTCGAGTTGACAGTGTAGATGATATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009911.2-732s1c1
Sequence:CCGGGTGTTTCAATTCCAGCATATACTCGAGTATATGCTGGAATTGAAACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009911
CXCR4 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) receptor 4
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009911.3-1171s21c1
Sequence:CCGGCACTTATGCAAAGACATATATCTCGAGATATATGTCTTTGCATAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009911.2-1118s1c1
Sequence:CCGGCAAGATCCTTTCCAAAGGAAACTCGAGTTTCCTTTGGAAAGGATCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009911.2-147s1c1
Sequence:CCGGACTTCTGATAACTACTCTGAACTCGAGTTCAGAGTAGTTATCAGAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009911.2-623s1c1
Sequence:CCGGCCTGACTATACCTGACTTCATCTCGAGATGAAGTCAGGTATAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009911.2-461s1c1
Sequence:CCGGCCATATCATCTACACTGTCAACTCGAGTTGACAGTGTAGATGATATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009911.2-732s1c1
Sequence:CCGGGTGTTTCAATTCCAGCATATACTCGAGTATATGCTGGAATTGAAACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009911
CXCR4 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) receptor 4
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009911.3-1171s21c1
Sequence:CCGGCACTTATGCAAAGACATATATCTCGAGATATATGTCTTTGCATAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009911.2-1118s1c1
Sequence:CCGGCAAGATCCTTTCCAAAGGAAACTCGAGTTTCCTTTGGAAAGGATCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009911.2-147s1c1
Sequence:CCGGACTTCTGATAACTACTCTGAACTCGAGTTCAGAGTAGTTATCAGAAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009911.2-623s1c1
Sequence:CCGGCCTGACTATACCTGACTTCATCTCGAGATGAAGTCAGGTATAGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009911.2-461s1c1
Sequence:CCGGCCATATCATCTACACTGTCAACTCGAGTTGACAGTGTAGATGATATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009911.2-732s1c1
Sequence:CCGGGTGTTTCAATTCCAGCATATACTCGAGTATATGCTGGAATTGAAACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks