EMAIL THIS PAGE TO A FRIEND

CXCR5

chemokine (C-X-C motif) receptor 5

84 Gene Product Result for
Synonyms: BLR1 CD185 MDR15
UniProtKB ID: P32302, Q14811
Gene ID:
Human(643) Summary: This gene encodes a multi-pass membrane protein that belongs to the CXC chemokine receptor family. It is expressed in mature B-cells and Burkitt's lymphoma. This cytokine receptor binds to B-lymphocyte chemoattractant (BLC), and is involved in B-cell migration into B-cell follicles of spleen and Peyer patches. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Mouse(12145) chemokine (C-X-C motif) receptor 5
Rat(29363) chemokine (C-X-C motif) receptor 5
chicken(419784) chemokine (C-X-C motif) receptor 5
domestic cat(101092459) chemokine (C-X-C motif) receptor 5
cow(497021) chemokine (C-X-C motif) receptor 5
dog(489378) chemokine (C-X-C motif) receptor 5
sheep(101104174) chemokine (C-X-C motif) receptor 5
Domestic Rabbit(100144335) chemokine (C-X-C motif) receptor 5
domestic guinea pig(100723743) chemokine (C-X-C motif) receptor 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001716 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001716 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001716 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007551 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007551 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007551 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033091 MISSION® esiRNA esiRNA human CXCR5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001716 Rosetta Predictions human pricing
NM_032966 Rosetta Predictions human pricing
NM_053303 Rosetta Predictions rat pricing
NM_007551 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244955 predicted 890
2 SASI_Hs01_00244956 predicted 1334
3 SASI_Hs01_00244957 predicted 1187
4 SASI_Hs01_00244958 predicted 664
5 SASI_Hs01_00244959 predicted 1323
6 SASI_Hs01_00244960 predicted 1550
7 SASI_Hs01_00244961 predicted 1181
8 SASI_Hs01_00244962 predicted 1620
9 SASI_Hs02_00332413 predicted 1518
10 SASI_Hs02_00332414 predicted 1535
11 SASI_Hs01_00244954 predicted 1496
12 SASI_Hs01_00244963 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201568 predicted 933
2 SASI_Hs01_00201569 predicted 1373
3 SASI_Hs01_00201570 predicted 1234
4 SASI_Hs01_00201571 predicted 709
5 SASI_Hs01_00201572 predicted 1367
6 SASI_Hs01_00201573 predicted 1597
7 SASI_Hs01_00201574 predicted 1225
8 SASI_Hs01_00201575 predicted 1661
9 SASI_Hs02_00360592 predicted 1563
10 SASI_Hs02_00360593 predicted 1578
11 SASI_Hs01_00201567 predicted 1559
12 SASI_Hs01_00201576 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053303 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116223 predicted 864
2 SASI_Rn02_00265695 predicted 900
3 SASI_Rn01_00116224 predicted 822
4 SASI_Rn01_00116225 predicted 640
5 SASI_Rn01_00116226 predicted 911
6 SASI_Rn01_00116227 predicted 531
7 SASI_Rn01_00116228 predicted 204
8 SASI_Rn01_00116229 predicted 712
9 SASI_Rn01_00116230 predicted 286
10 SASI_Rn01_00116231 predicted 430
11 SASI_Rn01_00116232 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110287 predicted 1345
2 SASI_Mm01_00110289 predicted 1276
3 SASI_Mm01_00110290 predicted 412
4 SASI_Mm01_00110291 predicted 678
5 SASI_Mm01_00110293 predicted 559
6 SASI_Mm01_00110294 predicted 721
7 SASI_Mm01_00110295 predicted 1367
8 SASI_Mm02_00311910 predicted 619
9 SASI_Mm02_00311911 predicted 1366
10 SASI_Mm02_00311912 predicted 1343
11 SASI_Mm01_00110288 predicted 1143
12 SASI_Mm01_00110292 predicted 1160
13 SASI_Mm01_00110296 predicted 1401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001716
CXCR5 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) receptor 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001716.2-1494s1c1
Sequence:CCGGCCTCCCATCCTAATCATCCAACTCGAGTTGGATGATTAGGATGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001716.2-382s1c1
Sequence:CCGGCTGGTCTTCATCTTGCCCTTTCTCGAGAAAGGGCAAGATGAAGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001716.2-631s1c1
Sequence:CCGGCCAGAGATTCTCTTCGCCAAACTCGAGTTTGGCGAAGAGAATCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001716.2-870s1c1
Sequence:CCGGCCTGGTGACAAGCATCTTCTTCTCGAGAAGAAGATGCTTGTCACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001716.2-145s1c1
Sequence:CCGGCTGGACAGATTGGACAACTATCTCGAGATAGTTGTCCAATCTGTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001716.3-646s21c1
Sequence:CCGGTCCTTGCCTTGCCAGAGATTCCTCGAGGAATCTCTGGCAAGGCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001716.3-982s21c1
Sequence:CCGGACAATACCTGCAAGCTGAATGCTCGAGCATTCAGCTTGCAGGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001716.3-1336s21c1
Sequence:CCGGGTCCTAGGAGTATCCTCATTTCTCGAGAAATGAGGATACTCCTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001716.3-1513s21c1
Sequence:CCGGTCACGCACCTCCCATCCTAATCTCGAGATTAGGATGGGAGGTGCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001716
CXCR5 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) receptor 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001716.2-1494s1c1
Sequence:CCGGCCTCCCATCCTAATCATCCAACTCGAGTTGGATGATTAGGATGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001716.2-382s1c1
Sequence:CCGGCTGGTCTTCATCTTGCCCTTTCTCGAGAAAGGGCAAGATGAAGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001716.2-631s1c1
Sequence:CCGGCCAGAGATTCTCTTCGCCAAACTCGAGTTTGGCGAAGAGAATCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001716.2-870s1c1
Sequence:CCGGCCTGGTGACAAGCATCTTCTTCTCGAGAAGAAGATGCTTGTCACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001716.2-145s1c1
Sequence:CCGGCTGGACAGATTGGACAACTATCTCGAGATAGTTGTCCAATCTGTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001716.3-646s21c1
Sequence:CCGGTCCTTGCCTTGCCAGAGATTCCTCGAGGAATCTCTGGCAAGGCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001716.3-982s21c1
Sequence:CCGGACAATACCTGCAAGCTGAATGCTCGAGCATTCAGCTTGCAGGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001716.3-1336s21c1
Sequence:CCGGGTCCTAGGAGTATCCTCATTTCTCGAGAAATGAGGATACTCCTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001716.3-1513s21c1
Sequence:CCGGTCACGCACCTCCCATCCTAATCTCGAGATTAGGATGGGAGGTGCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001716
CXCR5 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) receptor 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008137    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001716.2-1494s1c1
Sequence:CCGGCCTCCCATCCTAATCATCCAACTCGAGTTGGATGATTAGGATGGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001716.2-382s1c1
Sequence:CCGGCTGGTCTTCATCTTGCCCTTTCTCGAGAAAGGGCAAGATGAAGACCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001716.2-631s1c1
Sequence:CCGGCCAGAGATTCTCTTCGCCAAACTCGAGTTTGGCGAAGAGAATCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001716.2-870s1c1
Sequence:CCGGCCTGGTGACAAGCATCTTCTTCTCGAGAAGAAGATGCTTGTCACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001716.2-145s1c1
Sequence:CCGGCTGGACAGATTGGACAACTATCTCGAGATAGTTGTCCAATCTGTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001716.3-646s21c1
Sequence:CCGGTCCTTGCCTTGCCAGAGATTCCTCGAGGAATCTCTGGCAAGGCAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001716.3-982s21c1
Sequence:CCGGACAATACCTGCAAGCTGAATGCTCGAGCATTCAGCTTGCAGGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001716.3-1336s21c1
Sequence:CCGGGTCCTAGGAGTATCCTCATTTCTCGAGAAATGAGGATACTCCTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356785    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001716.3-1513s21c1
Sequence:CCGGTCACGCACCTCCCATCCTAATCTCGAGATTAGGATGGGAGGTGCGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007551
CXCR5 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) receptor 5
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000027381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007551.2-742s1c1
Sequence:CCGGGCTTGTGATGGGATGGTGTTACTCGAGTAACACCATCCCATCACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007551.2-1083s1c1
Sequence:CCGGCGGCCTCCCTTTGCCAACTTTCTCGAGAAAGTTGGCAAAGGGAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007551.2-868s1c1
Sequence:CCGGGCCCTACCACATTGTCATCTTCTCGAGAAGATGACAATGTGGTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007551.2-626s1c1
Sequence:CCGGCCTCATAACAACGACTCCTTACTCGAGTAAGGAGTCGTTGTTATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007551
CXCR5 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) receptor 5
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000027381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007551.2-742s1c1
Sequence:CCGGGCTTGTGATGGGATGGTGTTACTCGAGTAACACCATCCCATCACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007551.2-1083s1c1
Sequence:CCGGCGGCCTCCCTTTGCCAACTTTCTCGAGAAAGTTGGCAAAGGGAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007551.2-868s1c1
Sequence:CCGGGCCCTACCACATTGTCATCTTCTCGAGAAGATGACAATGTGGTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007551.2-626s1c1
Sequence:CCGGCCTCATAACAACGACTCCTTACTCGAGTAAGGAGTCGTTGTTATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007551
CXCR5 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) receptor 5
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000027381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007551.2-742s1c1
Sequence:CCGGGCTTGTGATGGGATGGTGTTACTCGAGTAACACCATCCCATCACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007551.2-1083s1c1
Sequence:CCGGCGGCCTCCCTTTGCCAACTTTCTCGAGAAAGTTGGCAAAGGGAGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007551.2-868s1c1
Sequence:CCGGGCCCTACCACATTGTCATCTTCTCGAGAAGATGACAATGTGGTAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007551.2-626s1c1
Sequence:CCGGCCTCATAACAACGACTCCTTACTCGAGTAAGGAGTCGTTGTTATGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks