EMAIL THIS PAGE TO A FRIEND

CXCR6

chemokine (C-X-C motif) receptor 6

56 Gene Product Result for
Synonyms: BONZO CD186 STRL33 TYMSTR
UniProtKB ID: O00574, O00575, Q9HCA5
Gene ID:
Mouse(80901) chemokine (C-X-C motif) receptor 6
Rat(100124593) chemokine (C-X-C motif) receptor 6
naked mole-rat(101725825) chemokine (C-X-C motif) receptor 6
sheep(101118482) chemokine (C-X-C motif) receptor 6
domestic cat(101083494) chemokine (C-X-C motif) receptor 6
cow(506807) chemokine (C-X-C motif) receptor 6
dog(608840) chemokine (C-X-C motif) receptor 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006564 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006564 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006564 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030712 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030712 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030712 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042211 MISSION® esiRNA esiRNA human CXCR6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006564 Rosetta Predictions human pricing
NM_001102587 Rosetta Predictions rat pricing
NM_030712 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247171 predicted 482
2 SASI_Hs01_00247172 predicted 1156
3 SASI_Hs01_00247173 predicted 394
4 SASI_Hs01_00247174 predicted 751
5 SASI_Hs01_00247176 predicted 607
6 SASI_Hs01_00247177 predicted 616
7 SASI_Hs01_00247178 predicted 825
8 SASI_Hs01_00247179 predicted 709
9 SASI_Hs01_00247180 predicted 758
10 SASI_Hs02_00341835 predicted 360
11 SASI_Hs01_00247175 predicted 953
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102587 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211494 predicted 755
2 SASI_Rn02_00211495 predicted 580
3 SASI_Rn02_00211496 predicted 436
4 SASI_Rn02_00211497 predicted 827
5 SASI_Rn02_00211498 predicted 544
6 SASI_Rn02_00211499 predicted 406
7 SASI_Rn02_00211500 predicted 706
8 SASI_Rn02_00211501 predicted 699
9 SASI_Rn02_00211502 predicted 477
10 SASI_Rn02_00211503 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038465 predicted 506
2 SASI_Mm01_00038466 predicted 200
3 SASI_Mm01_00038468 predicted 1131
4 SASI_Mm01_00038469 predicted 859
5 SASI_Mm01_00038470 predicted 1172
6 SASI_Mm02_00336897 predicted 420
7 SASI_Mm02_00336898 predicted 1033
8 SASI_Mm02_00336899 predicted 1221
9 SASI_Mm01_00038471 predicted 650
10 SASI_Mm01_00038472 predicted 762
11 SASI_Mm01_00038467 predicted 438
12 SASI_Mm01_00038473 predicted 1163
13 SASI_Mm01_00038474 predicted 614
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006564
CXCR6 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) receptor 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006564.1-244s21c1
Sequence:CCGGATATCCATCTTCTACCATAAGCTCGAGCTTATGGTAGAAGATGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006564.1-395s21c1
Sequence:CCGGTACTGGGCATCTACACTATTACTCGAGTAATAGTGTAGATGCCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006564.1-581s21c1
Sequence:CCGGTTATCTATGGCAATGTCTTTACTCGAGTAAAGACATTGCCATAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006564.1-1201s1c1
Sequence:CCGGGCGCATTCTCATGGAGAAGTTCTCGAGAACTTCTCCATGAGAATGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006564.1-536s1c1
Sequence:CCGGGCTTGCTCATCTGGGTGATATCTCGAGATATCACCCAGATGAGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006564.1-1043s1c1
Sequence:CCGGCTGAGGACAATTCCAAGACTTCTCGAGAAGTCTTGGAATTGTCCTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006564.1-243s1c1
Sequence:CCGGCATATCCATCTTCTACCATAACTCGAGTTATGGTAGAAGATGGATATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006564.1-694s1c1
Sequence:CCGGCTCACCATGATTGTCTGCTATCTCGAGATAGCAGACAATCATGGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006564
CXCR6 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) receptor 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006564.1-244s21c1
Sequence:CCGGATATCCATCTTCTACCATAAGCTCGAGCTTATGGTAGAAGATGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006564.1-395s21c1
Sequence:CCGGTACTGGGCATCTACACTATTACTCGAGTAATAGTGTAGATGCCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006564.1-581s21c1
Sequence:CCGGTTATCTATGGCAATGTCTTTACTCGAGTAAAGACATTGCCATAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006564.1-1201s1c1
Sequence:CCGGGCGCATTCTCATGGAGAAGTTCTCGAGAACTTCTCCATGAGAATGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006564.1-536s1c1
Sequence:CCGGGCTTGCTCATCTGGGTGATATCTCGAGATATCACCCAGATGAGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006564.1-1043s1c1
Sequence:CCGGCTGAGGACAATTCCAAGACTTCTCGAGAAGTCTTGGAATTGTCCTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006564.1-243s1c1
Sequence:CCGGCATATCCATCTTCTACCATAACTCGAGTTATGGTAGAAGATGGATATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006564.1-694s1c1
Sequence:CCGGCTCACCATGATTGTCTGCTATCTCGAGATAGCAGACAATCATGGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006564
CXCR6 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) receptor 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006564.1-244s21c1
Sequence:CCGGATATCCATCTTCTACCATAAGCTCGAGCTTATGGTAGAAGATGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356930    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006564.1-395s21c1
Sequence:CCGGTACTGGGCATCTACACTATTACTCGAGTAATAGTGTAGATGCCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006564.1-581s21c1
Sequence:CCGGTTATCTATGGCAATGTCTTTACTCGAGTAAAGACATTGCCATAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006564.1-1201s1c1
Sequence:CCGGGCGCATTCTCATGGAGAAGTTCTCGAGAACTTCTCCATGAGAATGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006564.1-536s1c1
Sequence:CCGGGCTTGCTCATCTGGGTGATATCTCGAGATATCACCCAGATGAGCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006564.1-1043s1c1
Sequence:CCGGCTGAGGACAATTCCAAGACTTCTCGAGAAGTCTTGGAATTGTCCTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006564.1-243s1c1
Sequence:CCGGCATATCCATCTTCTACCATAACTCGAGTTATGGTAGAAGATGGATATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006564.1-694s1c1
Sequence:CCGGCTCACCATGATTGTCTGCTATCTCGAGATAGCAGACAATCATGGTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030712
CXCR6 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-X-C motif) receptor 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030712.2-733s1c1
Sequence:CCGGGCTCACTATGATTCTGTGCTACTCGAGTAGCACAGAATCATAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030712.2-1703s1c1
Sequence:CCGGGCCAGAATAAATAAGCTGAATCTCGAGATTCAGCTTATTTATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030712.2-857s1c1
Sequence:CCGGCCCTTCAACCTTGCCATGTTACTCGAGTAACATGGCAAGGTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030712.2-200s1c1
Sequence:CCGGCTAAAGTTCAAGGAGGTCTTTCTCGAGAAAGACCTCCTTGAACTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030712.2-565s1c1
Sequence:CCGGCCAAGTCATTTGCTTGCTCATCTCGAGATGAGCAAGCAAATGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030712
CXCR6 MISSION shRNA shRNA Plasmid DNA
chemokine (C-X-C motif) receptor 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030712.2-733s1c1
Sequence:CCGGGCTCACTATGATTCTGTGCTACTCGAGTAGCACAGAATCATAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030712.2-1703s1c1
Sequence:CCGGGCCAGAATAAATAAGCTGAATCTCGAGATTCAGCTTATTTATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030712.2-857s1c1
Sequence:CCGGCCCTTCAACCTTGCCATGTTACTCGAGTAACATGGCAAGGTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030712.2-200s1c1
Sequence:CCGGCTAAAGTTCAAGGAGGTCTTTCTCGAGAAAGACCTCCTTGAACTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030712.2-565s1c1
Sequence:CCGGCCAAGTCATTTGCTTGCTCATCTCGAGATGAGCAAGCAAATGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030712
CXCR6 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-X-C motif) receptor 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030712.2-733s1c1
Sequence:CCGGGCTCACTATGATTCTGTGCTACTCGAGTAGCACAGAATCATAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066408    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030712.2-1703s1c1
Sequence:CCGGGCCAGAATAAATAAGCTGAATCTCGAGATTCAGCTTATTTATTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030712.2-857s1c1
Sequence:CCGGCCCTTCAACCTTGCCATGTTACTCGAGTAACATGGCAAGGTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030712.2-200s1c1
Sequence:CCGGCTAAAGTTCAAGGAGGTCTTTCTCGAGAAAGACCTCCTTGAACTTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030712.2-565s1c1
Sequence:CCGGCCAAGTCATTTGCTTGCTCATCTCGAGATGAGCAAGCAAATGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks