EMAIL THIS PAGE TO A FRIEND

CXXC11

CXXC finger protein 11

22 Gene Product Result for
Synonyms: C2orf85
UniProtKB ID: Q14D33, Q8N2A5
Gene ID:
cow(511818) CXXC finger protein 11
domestic cat(101098814) CXXC finger protein 11
dog(486214) CXXC finger protein 11
naked mole-rat(101725147) CXXC finger protein 11
domestic guinea pig(100728632) CXXC finger protein 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173821 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173821 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173821 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU023221 MISSION® esiRNA esiRNA human AC131097.1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173821 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173821 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368678 predicted 1516
2 SASI_Hs01_00147182 predicted 1445
3 SASI_Hs02_00368679 predicted 1507
4 SASI_Hs01_00147183 predicted 868
5 SASI_Hs02_00368680 predicted 1544
6 SASI_Hs01_00147184 predicted 216
7 SASI_Hs01_00147185 predicted 1305
8 SASI_Hs02_00368681 predicted 640
9 SASI_Hs01_00147188 predicted 866
10 SASI_Hs01_00147189 predicted 1528
11 SASI_Hs01_00147186 predicted 1430
12 SASI_Hs01_00147187 predicted 1429
13 SASI_Hs01_00147190 predicted 650
14 SASI_Hs01_00147191 predicted 739
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173821
CXXC11 MISSION shRNA Bacterial Glycerol Stock
CXXC finger protein 11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173821.1-1456s1c1
Sequence:CCGGCGCAGTCTTCGATGTCATAAACTCGAGTTTATGACATCGAAGACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173821.1-1140s1c1
Sequence:CCGGCCTTCATCTTTACTGATGTCACTCGAGTGACATCAGTAAAGATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173821.1-1462s1c1
Sequence:CCGGCTTCGATGTCATAAAGCGCAACTCGAGTTGCGCTTTATGACATCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173821.1-1313s1c1
Sequence:CCGGGTCCAAGGCAAAGATGCCTTTCTCGAGAAAGGCATCTTTGCCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173821.1-1530s1c1
Sequence:CCGGCCCAAGGCTATTACCAGAAGACTCGAGTCTTCTGGTAATAGCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173821.1-1141s1c1
Sequence:CCGGCTTCATCTTTACTGATGTCAACTCGAGTTGACATCAGTAAAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173821.2-1694s21c1
Sequence:CCGGGATGTGCATGTGTCGGCTGAACTCGAGTTCAGCCGACACATGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173821.2-1323s21c1
Sequence:CCGGGCCTTTACTGACATCACTGAACTCGAGTTCAGTGATGTCAGTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173821
CXXC11 MISSION shRNA shRNA Plasmid DNA
CXXC finger protein 11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173821.1-1456s1c1
Sequence:CCGGCGCAGTCTTCGATGTCATAAACTCGAGTTTATGACATCGAAGACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173821.1-1140s1c1
Sequence:CCGGCCTTCATCTTTACTGATGTCACTCGAGTGACATCAGTAAAGATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173821.1-1462s1c1
Sequence:CCGGCTTCGATGTCATAAAGCGCAACTCGAGTTGCGCTTTATGACATCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173821.1-1313s1c1
Sequence:CCGGGTCCAAGGCAAAGATGCCTTTCTCGAGAAAGGCATCTTTGCCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173821.1-1530s1c1
Sequence:CCGGCCCAAGGCTATTACCAGAAGACTCGAGTCTTCTGGTAATAGCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173821.1-1141s1c1
Sequence:CCGGCTTCATCTTTACTGATGTCAACTCGAGTTGACATCAGTAAAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173821.2-1694s21c1
Sequence:CCGGGATGTGCATGTGTCGGCTGAACTCGAGTTCAGCCGACACATGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173821.2-1323s21c1
Sequence:CCGGGCCTTTACTGACATCACTGAACTCGAGTTCAGTGATGTCAGTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173821
CXXC11 MISSION shRNA Lentiviral Transduction Particles
CXXC finger protein 11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173821.1-1456s1c1
Sequence:CCGGCGCAGTCTTCGATGTCATAAACTCGAGTTTATGACATCGAAGACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173821.1-1140s1c1
Sequence:CCGGCCTTCATCTTTACTGATGTCACTCGAGTGACATCAGTAAAGATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148486    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173821.1-1462s1c1
Sequence:CCGGCTTCGATGTCATAAAGCGCAACTCGAGTTGCGCTTTATGACATCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196140    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173821.1-1313s1c1
Sequence:CCGGGTCCAAGGCAAAGATGCCTTTCTCGAGAAAGGCATCTTTGCCTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173821.1-1530s1c1
Sequence:CCGGCCCAAGGCTATTACCAGAAGACTCGAGTCTTCTGGTAATAGCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173821.1-1141s1c1
Sequence:CCGGCTTCATCTTTACTGATGTCAACTCGAGTTGACATCAGTAAAGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173821.2-1694s21c1
Sequence:CCGGGATGTGCATGTGTCGGCTGAACTCGAGTTCAGCCGACACATGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173821.2-1323s21c1
Sequence:CCGGGCCTTTACTGACATCACTGAACTCGAGTTCAGTGATGTCAGTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks