EMAIL THIS PAGE TO A FRIEND

CXXC1

CXXC finger protein 1

90 Gene Product Result for
Synonyms: 2410002I16Rik 5830420C16Rik CFP1 CGBP HsT2645 PCCX1 PHF18 SPP1 ZCGPC1 hCGBP
UniProtKB ID: Q9P0U4, B2RC03, Q8N2W4, Q96BC8, Q9P2V7
Gene ID:
Human(30827) Summary: Proteins that contain a CXXC motif within their DNA-binding domain, such as CXXC1, recognize CpG sequences and regulate gene expression (Carlone and Skalnik, 2001 [PubMed 11604496]
Mouse(74322) CXXC finger 1 (PHD domain)
Rat(291440) CXXC finger protein 1
Goat(100861333) CXXC finger protein 1
sheep(101112691) CXXC finger protein 1
domestic guinea pig(100714594) CXXC finger protein 1
naked mole-rat(101698776) CXXC finger protein 1
Zebrafish(360150) CXXC finger 1 (PHD domain)
dog(480217) CXXC finger protein 1
domestic cat(101091565) CXXC finger protein 1
cow(511446) CXXC finger protein 1
Horse(100069452) CXXC finger protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV39110 Anti-CXXC1 antibody produced in rabbit IgG fraction of antiserum guinea pig, zebrafish, rabbit, human, rat, canine, mouse, horse, bovine
western blot pricing
SAB2103447 Anti-CXXC1 antibody produced in rabbit affinity isolated antibody mouse, rabbit, canine, bovine, guinea pig, human, rat, horse
western blot pricing
HPA044511 Anti-CXXC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028868 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028868 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028868 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014593 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014593 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014593 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101654 Rosetta Predictions human pricing
NM_014593 Rosetta Predictions human pricing
NM_001079698 Rosetta Predictions rat pricing
NM_028868 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322879 predicted 2104
2 SASI_Hs02_00322880 predicted 2252
3 SASI_Hs02_00322881 predicted 2503
4 SASI_Hs02_00322882 predicted 797
5 SASI_Hs02_00322883 predicted 2281
6 SASI_Hs02_00322884 predicted 2319
7 SASI_Hs02_00322885 predicted 2225
8 SASI_Hs02_00322886 predicted 2152
9 SASI_Hs02_00322887 predicted 2503
10 SASI_Hs02_00322888 predicted 817
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014593 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345867 predicted 2096
2 SASI_Hs02_00345868 predicted 2243
3 SASI_Hs02_00345869 predicted 2497
4 SASI_Hs01_00057444 predicted 796
5 SASI_Hs02_00345870 predicted 2270
6 SASI_Hs02_00345871 predicted 2310
7 SASI_Hs02_00345872 predicted 2212
8 SASI_Hs02_00345873 predicted 2139
9 SASI_Hs01_00057447 predicted 2490
10 SASI_Hs02_00345874 predicted 816
11 SASI_Hs01_00057443 predicted 1808
12 SASI_Hs01_00057445 predicted 1392
13 SASI_Hs01_00057446 predicted 1261
14 SASI_Hs01_00057448 predicted 1396
15 SASI_Hs01_00057449 predicted 2051
16 SASI_Hs01_00057450 predicted 974
17 SASI_Hs01_00057451 predicted 2069
18 SASI_Hs01_00057452 predicted 1818
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208009 predicted 1906
2 SASI_Rn02_00208010 predicted 921
3 SASI_Rn02_00208011 predicted 1684
4 SASI_Rn02_00208012 predicted 1980
5 SASI_Rn02_00208013 predicted 2010
6 SASI_Rn02_00208014 predicted 1597
7 SASI_Rn02_00208015 predicted 1592
8 SASI_Rn02_00208016 predicted 1059
9 SASI_Rn02_00208017 predicted 1902
10 SASI_Rn02_00208018 predicted 1652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177368 predicted 2171
2 SASI_Mm01_00177369 predicted 2120
3 SASI_Mm01_00177370 predicted 1790
4 SASI_Mm01_00177371 predicted 2044
5 SASI_Mm01_00177372 predicted 1638
6 SASI_Mm01_00177373 predicted 508
7 SASI_Mm01_00177374 predicted 1310
8 SASI_Mm01_00177377 predicted 2104
9 SASI_Mm02_00334544 predicted 1435
10 SASI_Mm02_00334545 predicted 2223
11 SASI_Mm01_00177375 predicted 2039
12 SASI_Mm01_00177376 predicted 1687
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028868
CXXC1 MISSION shRNA Bacterial Glycerol Stock
CXXC finger protein 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028868.3-2032s21c1
Sequence:CCGGGCGCCAGTGTAATCGCCATTACTCGAGTAATGGCGATTACACTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028868.3-1635s21c1
Sequence:CCGGACGAGCTTGAGGCCATCATTCCTCGAGGAATGATGGCCTCAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028868.3-360s21c1
Sequence:CCGGGTCGCAAACCGGACATCAATTCTCGAGAATTGATGTCCGGTTTGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028868.3-2339s21c1
Sequence:CCGGTCTTCTGCTGCCCTTAGTTTGCTCGAGCAAACTAAGGGCAGCAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193102    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028868.1-2320s1c2
Sequence:CCGGCGTTCCTCCATTCATCTGTTTCTCGAGAAACAGATGAATGGAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176299    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028868.1-2351s1c1
Sequence:CCGGCCTTAGTTTGATCCTCACCATCTCGAGATGGTGAGGATCAAACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028868.1-1779s1c1
Sequence:CCGGCGTCACATGGAACGTTGCTATCTCGAGATAGCAACGTTCCATGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028868
CXXC1 MISSION shRNA shRNA Plasmid DNA
CXXC finger protein 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028868.3-2032s21c1
Sequence:CCGGGCGCCAGTGTAATCGCCATTACTCGAGTAATGGCGATTACACTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028868.3-1635s21c1
Sequence:CCGGACGAGCTTGAGGCCATCATTCCTCGAGGAATGATGGCCTCAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028868.3-360s21c1
Sequence:CCGGGTCGCAAACCGGACATCAATTCTCGAGAATTGATGTCCGGTTTGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028868.3-2339s21c1
Sequence:CCGGTCTTCTGCTGCCCTTAGTTTGCTCGAGCAAACTAAGGGCAGCAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193102    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028868.1-2320s1c2
Sequence:CCGGCGTTCCTCCATTCATCTGTTTCTCGAGAAACAGATGAATGGAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176299    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028868.1-2351s1c1
Sequence:CCGGCCTTAGTTTGATCCTCACCATCTCGAGATGGTGAGGATCAAACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028868.1-1779s1c1
Sequence:CCGGCGTCACATGGAACGTTGCTATCTCGAGATAGCAACGTTCCATGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028868
CXXC1 MISSION shRNA Lentiviral Transduction Particles
CXXC finger protein 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028868.3-2032s21c1
Sequence:CCGGGCGCCAGTGTAATCGCCATTACTCGAGTAATGGCGATTACACTGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028868.3-1635s21c1
Sequence:CCGGACGAGCTTGAGGCCATCATTCCTCGAGGAATGATGGCCTCAAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028868.3-360s21c1
Sequence:CCGGGTCGCAAACCGGACATCAATTCTCGAGAATTGATGTCCGGTTTGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028868.3-2339s21c1
Sequence:CCGGTCTTCTGCTGCCCTTAGTTTGCTCGAGCAAACTAAGGGCAGCAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193102    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028868.1-2320s1c2
Sequence:CCGGCGTTCCTCCATTCATCTGTTTCTCGAGAAACAGATGAATGGAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176299    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028868.1-2351s1c1
Sequence:CCGGCCTTAGTTTGATCCTCACCATCTCGAGATGGTGAGGATCAAACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028868.1-1779s1c1
Sequence:CCGGCGTCACATGGAACGTTGCTATCTCGAGATAGCAACGTTCCATGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014593
VALIDATED
CXXC1 MISSION shRNA Bacterial Glycerol Stock
CXXC finger protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014593.1-970s1c1
Sequence:CCGGCCACAGCCATCACAGAAGTTACTCGAGTAACTTCTGTGATGGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014593.1-399s1c1
Sequence:CCGGCATCCGGATCACTGAGAAGATCTCGAGATCTTCTCAGTGATCCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014593.1-873s1c1
Sequence:CCGGCCGGGAATCGTACAAGTACTTCTCGAGAAGTACTTGTACGATTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014593.1-1834s1c1
Sequence:CCGGGTGTATAATCCTCAGAGCAAACTCGAGTTTGCTCTGAGGATTATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014593.1-1296s1c1
Sequence:CCGGGCACAAGGATAAATGGAAACACTCGAGTGTTTCCATTTATCCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_014593.1-1819s1c1
Sequence:CCGGCGACTCTTCTGTGATGTGTATCTCGAGATACACATCACAGAAGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014593.1-480s1c1
Sequence:CCGGGATTCGCTATCGGCACAAGAACTCGAGTTCTTGTGCCGATAGCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014593.1-2226s1c1
Sequence:CCGGCCTTAAACCCTGCATTCCAGACTCGAGTCTGGAATGCAGGGTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014593.1-2275s1c1
Sequence:CCGGCGTTCCTCCACTCATCTGTTTCTCGAGAAACAGATGAGTGGAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014593
VALIDATED
CXXC1 MISSION shRNA shRNA Plasmid DNA
CXXC finger protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014593.1-970s1c1
Sequence:CCGGCCACAGCCATCACAGAAGTTACTCGAGTAACTTCTGTGATGGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014593.1-399s1c1
Sequence:CCGGCATCCGGATCACTGAGAAGATCTCGAGATCTTCTCAGTGATCCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014593.1-873s1c1
Sequence:CCGGCCGGGAATCGTACAAGTACTTCTCGAGAAGTACTTGTACGATTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014593.1-1834s1c1
Sequence:CCGGGTGTATAATCCTCAGAGCAAACTCGAGTTTGCTCTGAGGATTATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014593.1-1296s1c1
Sequence:CCGGGCACAAGGATAAATGGAAACACTCGAGTGTTTCCATTTATCCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_014593.1-1819s1c1
Sequence:CCGGCGACTCTTCTGTGATGTGTATCTCGAGATACACATCACAGAAGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014593.1-480s1c1
Sequence:CCGGGATTCGCTATCGGCACAAGAACTCGAGTTCTTGTGCCGATAGCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014593.1-2226s1c1
Sequence:CCGGCCTTAAACCCTGCATTCCAGACTCGAGTCTGGAATGCAGGGTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014593.1-2275s1c1
Sequence:CCGGCGTTCCTCCACTCATCTGTTTCTCGAGAAACAGATGAGTGGAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014593
VALIDATED
CXXC1 MISSION shRNA Lentiviral Transduction Particles
CXXC finger protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_014593.1-970s1c1
Sequence:CCGGCCACAGCCATCACAGAAGTTACTCGAGTAACTTCTGTGATGGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014593.1-399s1c1
Sequence:CCGGCATCCGGATCACTGAGAAGATCTCGAGATCTTCTCAGTGATCCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014593.1-873s1c1
Sequence:CCGGCCGGGAATCGTACAAGTACTTCTCGAGAAGTACTTGTACGATTCCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014593.1-1834s1c1
Sequence:CCGGGTGTATAATCCTCAGAGCAAACTCGAGTTTGCTCTGAGGATTATACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014593.1-1296s1c1
Sequence:CCGGGCACAAGGATAAATGGAAACACTCGAGTGTTTCCATTTATCCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_014593.1-1819s1c1
Sequence:CCGGCGACTCTTCTGTGATGTGTATCTCGAGATACACATCACAGAAGAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014593.1-480s1c1
Sequence:CCGGGATTCGCTATCGGCACAAGAACTCGAGTTCTTGTGCCGATAGCGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155409    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_014593.1-2226s1c1
Sequence:CCGGCCTTAAACCCTGCATTCCAGACTCGAGTCTGGAATGCAGGGTTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155700    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_014593.1-2275s1c1
Sequence:CCGGCGTTCCTCCACTCATCTGTTTCTCGAGAAACAGATGAGTGGAGGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks