EMAIL THIS PAGE TO A FRIEND

CXXC4

CXXC finger protein 4

56 Gene Product Result for
Synonyms: IDAX
UniProtKB ID: Q9H2H0
Gene ID:
Mouse(319478) CXXC finger 4
Rat(83824) CXXC finger protein 4
cow(100337468) CXXC finger protein 4
dog(610189) CXXC finger protein 4
cow(539947) CXXC finger protein 4
sheep(101105249) CXXC finger protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025212 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025212 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025212 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001004367 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004367 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004367 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU012791 MISSION® esiRNA esiRNA targeting mouse Cxxc4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025212 Rosetta Predictions human pricing
NM_053342 Rosetta Predictions rat pricing
NM_001004367 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025212 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00111168 predicted 500
2 SASI_Hs01_00111169 predicted 471
3 SASI_Hs01_00111170 predicted 493
4 SASI_Hs01_00111171 predicted 439
5 SASI_Hs01_00111172 predicted 471
6 SASI_Hs01_00111173 predicted 493
7 SASI_Hs01_00111174 predicted 495
8 SASI_Hs01_00111175 predicted 303
9 SASI_Hs01_00111176 predicted 448
10 SASI_Hs01_00111177 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053342 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119985 predicted 503
2 SASI_Rn01_00119986 predicted 470
3 SASI_Rn02_00265798 predicted 337
4 SASI_Rn01_00119987 predicted 498
5 SASI_Rn01_00119988 predicted 438
6 SASI_Rn01_00119989 predicted 329
7 SASI_Rn01_00119990 predicted 310
8 SASI_Rn01_00119991 predicted 301
9 SASI_Rn01_00119993 predicted 333
10 SASI_Rn01_00119994 predicted 450
11 SASI_Rn01_00119992 predicted 504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028582 predicted 732
2 SASI_Mm02_00286544 predicted 315
3 SASI_Mm01_00028584 predicted 1096
4 SASI_Mm02_00286545 predicted 867
5 SASI_Mm01_00028585 predicted 1338
6 SASI_Mm01_00028586 predicted 1209
7 SASI_Mm01_00028587 predicted 1329
8 SASI_Mm01_00028588 predicted 928
9 SASI_Mm01_00028589 predicted 1274
10 SASI_Mm01_00028590 predicted 880
11 SASI_Mm01_00028583 predicted 880
12 SASI_Mm01_00028591 predicted 1325
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025212
CXXC4 MISSION shRNA Bacterial Glycerol Stock
CXXC finger protein 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025212.1-341s21c1
Sequence:CCGGCAGACTGCCCGCAGAATCATTCTCGAGAATGATTCTGCGGGCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025212.1-504s21c1
Sequence:CCGGACACCAGATCTGCAAATTTAGCTCGAGCTAAATTTGCAGATCTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025212.1-588s21c1
Sequence:CCGGTGAAGCATTCCGATGGTTCTTCTCGAGAAGAACCATCGGAATGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025212.1-653s21c1
Sequence:CCGGGGGCAAACTAATGTCTTGTTTCTCGAGAAACAAGACATTAGTTTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025212.1-172s1c1
Sequence:CCGGGCTGAAGCAGAGATAATGAATCTCGAGATTCATTATCTCTGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025212.1-315s1c1
Sequence:CCGGCAGTGCGTTTCAAATTGCCAACTCGAGTTGGCAATTTGAAACGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025212.1-554s1c1
Sequence:CCGGGCACTTCACTAGAGAGAACACCTCGAGGTGTTCTCTCTAGTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025212.1-307s1c1
Sequence:CCGGGTCACAGACAGTGCGTTTCAACTCGAGTTGAAACGCACTGTCTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025212.1-70s1c1
Sequence:CCGGCCGTCGTTGCAAATGGCAAATCTCGAGATTTGCCATTTGCAACGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025212.1-142s1c1
Sequence:CCGGGAATGCATGAACAAGCTCAAACTCGAGTTTGAGCTTGTTCATGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025212.1-175s1c1
Sequence:CCGGGAAGCAGAGATAATGAATCTCCTCGAGGAGATTCATTATCTCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025212
CXXC4 MISSION shRNA shRNA Plasmid DNA
CXXC finger protein 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025212.1-341s21c1
Sequence:CCGGCAGACTGCCCGCAGAATCATTCTCGAGAATGATTCTGCGGGCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025212.1-504s21c1
Sequence:CCGGACACCAGATCTGCAAATTTAGCTCGAGCTAAATTTGCAGATCTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025212.1-588s21c1
Sequence:CCGGTGAAGCATTCCGATGGTTCTTCTCGAGAAGAACCATCGGAATGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025212.1-653s21c1
Sequence:CCGGGGGCAAACTAATGTCTTGTTTCTCGAGAAACAAGACATTAGTTTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025212.1-172s1c1
Sequence:CCGGGCTGAAGCAGAGATAATGAATCTCGAGATTCATTATCTCTGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025212.1-315s1c1
Sequence:CCGGCAGTGCGTTTCAAATTGCCAACTCGAGTTGGCAATTTGAAACGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025212.1-554s1c1
Sequence:CCGGGCACTTCACTAGAGAGAACACCTCGAGGTGTTCTCTCTAGTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025212.1-307s1c1
Sequence:CCGGGTCACAGACAGTGCGTTTCAACTCGAGTTGAAACGCACTGTCTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025212.1-70s1c1
Sequence:CCGGCCGTCGTTGCAAATGGCAAATCTCGAGATTTGCCATTTGCAACGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025212.1-142s1c1
Sequence:CCGGGAATGCATGAACAAGCTCAAACTCGAGTTTGAGCTTGTTCATGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025212.1-175s1c1
Sequence:CCGGGAAGCAGAGATAATGAATCTCCTCGAGGAGATTCATTATCTCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025212
CXXC4 MISSION shRNA Lentiviral Transduction Particles
CXXC finger protein 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025212.1-341s21c1
Sequence:CCGGCAGACTGCCCGCAGAATCATTCTCGAGAATGATTCTGCGGGCAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025212.1-504s21c1
Sequence:CCGGACACCAGATCTGCAAATTTAGCTCGAGCTAAATTTGCAGATCTGGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025212.1-588s21c1
Sequence:CCGGTGAAGCATTCCGATGGTTCTTCTCGAGAAGAACCATCGGAATGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025212.1-653s21c1
Sequence:CCGGGGGCAAACTAATGTCTTGTTTCTCGAGAAACAAGACATTAGTTTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025212.1-172s1c1
Sequence:CCGGGCTGAAGCAGAGATAATGAATCTCGAGATTCATTATCTCTGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025212.1-315s1c1
Sequence:CCGGCAGTGCGTTTCAAATTGCCAACTCGAGTTGGCAATTTGAAACGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025212.1-554s1c1
Sequence:CCGGGCACTTCACTAGAGAGAACACCTCGAGGTGTTCTCTCTAGTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025212.1-307s1c1
Sequence:CCGGGTCACAGACAGTGCGTTTCAACTCGAGTTGAAACGCACTGTCTGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025212.1-70s1c1
Sequence:CCGGCCGTCGTTGCAAATGGCAAATCTCGAGATTTGCCATTTGCAACGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145088    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025212.1-142s1c1
Sequence:CCGGGAATGCATGAACAAGCTCAAACTCGAGTTTGAGCTTGTTCATGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025212.1-175s1c1
Sequence:CCGGGAAGCAGAGATAATGAATCTCCTCGAGGAGATTCATTATCTCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004367
CXXC4 MISSION shRNA Bacterial Glycerol Stock
CXXC finger protein 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004367.2-820s1c1
Sequence:CCGGGAAGCGTTCCGATGGTTCTTTCTCGAGAAAGAACCATCGGAACGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004367.2-2522s1c1
Sequence:CCGGGCCAAGACTTTAGAGTCTAAACTCGAGTTTAGACTCTAAAGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004367.2-317s1c1
Sequence:CCGGCAAATACTAATTTCCTCTCCACTCGAGTGGAGAGGAAATTAGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004367.2-399s1c1
Sequence:CCGGCGCTGCTGAAGCAGAGATAATCTCGAGATTATCTCTGCTTCAGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004367.2-305s1c1
Sequence:CCGGCGTTGCAAATGGCAAATACTACTCGAGTAGTATTTGCCATTTGCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004367.2-3169s1c1
Sequence:CCGGGCACACAATAAGGACCTCATACTCGAGTATGAGGTCCTTATTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004367.2-540s1c1
Sequence:CCGGCACAGACAGTGCGTTTCAAATCTCGAGATTTGAAACGCACTGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004367
CXXC4 MISSION shRNA shRNA Plasmid DNA
CXXC finger protein 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004367.2-820s1c1
Sequence:CCGGGAAGCGTTCCGATGGTTCTTTCTCGAGAAAGAACCATCGGAACGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004367.2-2522s1c1
Sequence:CCGGGCCAAGACTTTAGAGTCTAAACTCGAGTTTAGACTCTAAAGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004367.2-317s1c1
Sequence:CCGGCAAATACTAATTTCCTCTCCACTCGAGTGGAGAGGAAATTAGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004367.2-399s1c1
Sequence:CCGGCGCTGCTGAAGCAGAGATAATCTCGAGATTATCTCTGCTTCAGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004367.2-305s1c1
Sequence:CCGGCGTTGCAAATGGCAAATACTACTCGAGTAGTATTTGCCATTTGCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004367.2-3169s1c1
Sequence:CCGGGCACACAATAAGGACCTCATACTCGAGTATGAGGTCCTTATTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004367.2-540s1c1
Sequence:CCGGCACAGACAGTGCGTTTCAAATCTCGAGATTTGAAACGCACTGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004367
CXXC4 MISSION shRNA Lentiviral Transduction Particles
CXXC finger protein 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004367.2-820s1c1
Sequence:CCGGGAAGCGTTCCGATGGTTCTTTCTCGAGAAAGAACCATCGGAACGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004367.2-2522s1c1
Sequence:CCGGGCCAAGACTTTAGAGTCTAAACTCGAGTTTAGACTCTAAAGTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004367.2-317s1c1
Sequence:CCGGCAAATACTAATTTCCTCTCCACTCGAGTGGAGAGGAAATTAGTATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004367.2-399s1c1
Sequence:CCGGCGCTGCTGAAGCAGAGATAATCTCGAGATTATCTCTGCTTCAGCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004367.2-305s1c1
Sequence:CCGGCGTTGCAAATGGCAAATACTACTCGAGTAGTATTTGCCATTTGCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004367.2-3169s1c1
Sequence:CCGGGCACACAATAAGGACCTCATACTCGAGTATGAGGTCCTTATTGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004367.2-540s1c1
Sequence:CCGGCACAGACAGTGCGTTTCAAATCTCGAGATTTGAAACGCACTGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks