EMAIL THIS PAGE TO A FRIEND

CXXC5

CXXC finger protein 5

114 Gene Product Result for
Synonyms: CF5 RINF WID
UniProtKB ID: Q7LFL8, B3KND0, C8CBA8, Q8TB79, Q9NV51, Q9P0S8
Gene ID:
Mouse(67393) CXXC finger 5
Rat(291670) CXXC finger protein 5
Goat(100860937) CXXC finger protein 5
sheep(101116569) CXXC finger protein 5
domestic guinea pig(100718893) CXXC finger protein 5
naked mole-rat(101724740) CXXC finger protein 5
chicken(416138) CXXC finger protein 5
domestic cat(101092331) CXXC finger protein 5
cow(538485) CXXC finger protein 5
dog(487156) CXXC finger protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016463 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133687 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133687 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133687 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146121 MISSION® esiRNA esiRNA human CXXC5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016463 Rosetta Predictions human pricing
NM_001007628 Rosetta Predictions rat pricing
NM_133687 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349506 predicted 885
2 SASI_Hs01_00062311 predicted 1124
3 SASI_Hs01_00062312 predicted 1096
4 SASI_Hs01_00062313 predicted 774
5 SASI_Hs01_00062314 predicted 1060
6 SASI_Hs02_00349507 predicted 964
7 SASI_Hs01_00062316 predicted 929
8 SASI_Hs02_00349508 predicted 1027
9 SASI_Hs02_00349509 predicted 1036
10 SASI_Hs02_00349510 predicted 1042
11 SASI_Hs01_00062309 predicted 2028
12 SASI_Hs01_00062310 predicted 2052
13 SASI_Hs01_00062315 predicted 2053
14 SASI_Hs01_00062317 predicted 2037
15 SASI_Hs01_00062318 predicted 2030
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007628 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041025 predicted 716
2 SASI_Rn02_00198730 predicted 610
3 SASI_Rn01_00041026 predicted 886
4 SASI_Rn01_00041028 predicted 595
5 SASI_Rn02_00198731 predicted 607
6 SASI_Rn01_00041031 predicted 960
7 SASI_Rn02_00198732 predicted 968
8 SASI_Rn01_00041032 predicted 927
9 SASI_Rn01_00041033 predicted 455
10 SASI_Rn02_00198733 predicted 447
11 SASI_Rn01_00041027 predicted 1004
12 SASI_Rn01_00041029 predicted 976
13 SASI_Rn01_00041030 predicted 957
14 SASI_Rn01_00041034 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133687 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154767 predicted 909
2 SASI_Mm01_00154768 predicted 1713
3 SASI_Mm01_00154769 predicted 1077
4 SASI_Mm02_00338647 predicted 804
5 SASI_Mm01_00154770 predicted 1137
6 SASI_Mm01_00154771 predicted 1168
7 SASI_Mm01_00154772 predicted 1705
8 SASI_Mm01_00154773 predicted 637
9 SASI_Mm01_00154774 predicted 1121
10 SASI_Mm01_00154775 predicted 990
11 SASI_Mm01_00154776 predicted 611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016463
VALIDATED
CXXC5 MISSION shRNA Bacterial Glycerol Stock
CXXC finger protein 5
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016463.5-1902s1c1
Sequence:CCGGGAATGGACAATCAGTTTCCTTCTCGAGAAGGAAACTGATTGTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016463.5-2342s1c1
Sequence:CCGGCGATATTTCCAATCCTGGCTACTCGAGTAGCCAGGATTGGAAATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016463.5-1496s1c1
Sequence:CCGGGAAAGACTGGCCATCAGATTTCTCGAGAAATCTGATGGCCAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143092    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016463.5-2409s1c1
Sequence:CCGGCAACAGAAGAAAGGGCTTCTTCTCGAGAAGAAGCCCTTTCTTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016463.5-1892s1c1
Sequence:CCGGCCTGGGCAAAGAATGGACAATCTCGAGATTGTCCATTCTTTGCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139977    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016463.5-1500s1c1
Sequence:CCGGGACTGGCCATCAGATTTGCAACTCGAGTTGCAAATCTGATGGCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016463.5-1478s1c1
Sequence:CCGGGCAGCAGTTGTAGGAATCGAACTCGAGTTCGATTCCTACAACTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142730    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016463.5-2078s1c1
Sequence:CCGGCCGACCATGAAATAGTGCATACTCGAGTATGCACTATTTCATGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142729    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016463.5-2065s1c1
Sequence:CCGGCCTTTGATTCTTTCCGACCATCTCGAGATGGTCGGAAAGAATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016463.5-1173s1c1
Sequence:CCGGGCAGGAGCATCTCCCGCTGATCTCGAGATCAGCGGGAGATGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016463.5-1419s1c1
Sequence:CCGGGAAGCGGAAACGCTGCGGCATCTCGAGATGCCGCAGCGTTTCCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016463.7-1206s21c1
Sequence:CCGGGCTCTGGAGAAGGTGATGCTTCTCGAGAAGCATCACCTTCTCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000449804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016463.7-1046s21c1
Sequence:CCGGCATCAGCTCCGGCAAGAAGAACTCGAGTTCTTCTTGCCGGAGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016463.7-781s21c1
Sequence:CCGGAGTTTGCGCAGTCCACAGAGACTCGAGTCTCTGTGGACTGCGCAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000448754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016463.7-573s21c1
Sequence:CCGGAGCATGATGGGCGGAGAGTCTCTCGAGAGACTCTCCGCCCATCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016463.7-1371s21c1
Sequence:CCGGATTCTCTCACAGATTTCATTCCTCGAGGAATGAAATCTGTGAGAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016463
VALIDATED
CXXC5 MISSION shRNA shRNA Plasmid DNA
CXXC finger protein 5
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016463.5-1902s1c1
Sequence:CCGGGAATGGACAATCAGTTTCCTTCTCGAGAAGGAAACTGATTGTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016463.5-2342s1c1
Sequence:CCGGCGATATTTCCAATCCTGGCTACTCGAGTAGCCAGGATTGGAAATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016463.5-1496s1c1
Sequence:CCGGGAAAGACTGGCCATCAGATTTCTCGAGAAATCTGATGGCCAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143092    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016463.5-2409s1c1
Sequence:CCGGCAACAGAAGAAAGGGCTTCTTCTCGAGAAGAAGCCCTTTCTTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016463.5-1892s1c1
Sequence:CCGGCCTGGGCAAAGAATGGACAATCTCGAGATTGTCCATTCTTTGCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139977    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016463.5-1500s1c1
Sequence:CCGGGACTGGCCATCAGATTTGCAACTCGAGTTGCAAATCTGATGGCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016463.5-1478s1c1
Sequence:CCGGGCAGCAGTTGTAGGAATCGAACTCGAGTTCGATTCCTACAACTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142730    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016463.5-2078s1c1
Sequence:CCGGCCGACCATGAAATAGTGCATACTCGAGTATGCACTATTTCATGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142729    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016463.5-2065s1c1
Sequence:CCGGCCTTTGATTCTTTCCGACCATCTCGAGATGGTCGGAAAGAATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016463.5-1173s1c1
Sequence:CCGGGCAGGAGCATCTCCCGCTGATCTCGAGATCAGCGGGAGATGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016463.5-1419s1c1
Sequence:CCGGGAAGCGGAAACGCTGCGGCATCTCGAGATGCCGCAGCGTTTCCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016463.7-1206s21c1
Sequence:CCGGGCTCTGGAGAAGGTGATGCTTCTCGAGAAGCATCACCTTCTCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000449804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016463.7-1046s21c1
Sequence:CCGGCATCAGCTCCGGCAAGAAGAACTCGAGTTCTTCTTGCCGGAGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016463.7-781s21c1
Sequence:CCGGAGTTTGCGCAGTCCACAGAGACTCGAGTCTCTGTGGACTGCGCAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000448754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016463.7-573s21c1
Sequence:CCGGAGCATGATGGGCGGAGAGTCTCTCGAGAGACTCTCCGCCCATCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016463.7-1371s21c1
Sequence:CCGGATTCTCTCACAGATTTCATTCCTCGAGGAATGAAATCTGTGAGAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016463
VALIDATED
CXXC5 MISSION shRNA Lentiviral Transduction Particles
CXXC finger protein 5
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144558    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016463.5-1902s1c1
Sequence:CCGGGAATGGACAATCAGTTTCCTTCTCGAGAAGGAAACTGATTGTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016463.5-2342s1c1
Sequence:CCGGCGATATTTCCAATCCTGGCTACTCGAGTAGCCAGGATTGGAAATATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016463.5-1496s1c1
Sequence:CCGGGAAAGACTGGCCATCAGATTTCTCGAGAAATCTGATGGCCAGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143092    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016463.5-2409s1c1
Sequence:CCGGCAACAGAAGAAAGGGCTTCTTCTCGAGAAGAAGCCCTTTCTTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139498    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016463.5-1892s1c1
Sequence:CCGGCCTGGGCAAAGAATGGACAATCTCGAGATTGTCCATTCTTTGCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139977    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016463.5-1500s1c1
Sequence:CCGGGACTGGCCATCAGATTTGCAACTCGAGTTGCAAATCTGATGGCCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016463.5-1478s1c1
Sequence:CCGGGCAGCAGTTGTAGGAATCGAACTCGAGTTCGATTCCTACAACTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142730    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016463.5-2078s1c1
Sequence:CCGGCCGACCATGAAATAGTGCATACTCGAGTATGCACTATTTCATGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142729    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016463.5-2065s1c1
Sequence:CCGGCCTTTGATTCTTTCCGACCATCTCGAGATGGTCGGAAAGAATCAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016463.5-1173s1c1
Sequence:CCGGGCAGGAGCATCTCCCGCTGATCTCGAGATCAGCGGGAGATGCTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122415    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_016463.5-1419s1c1
Sequence:CCGGGAAGCGGAAACGCTGCGGCATCTCGAGATGCCGCAGCGTTTCCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016463.7-1206s21c1
Sequence:CCGGGCTCTGGAGAAGGTGATGCTTCTCGAGAAGCATCACCTTCTCCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000449804    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016463.7-1046s21c1
Sequence:CCGGCATCAGCTCCGGCAAGAAGAACTCGAGTTCTTCTTGCCGGAGCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016463.7-781s21c1
Sequence:CCGGAGTTTGCGCAGTCCACAGAGACTCGAGTCTCTGTGGACTGCGCAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000448754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016463.7-573s21c1
Sequence:CCGGAGCATGATGGGCGGAGAGTCTCTCGAGAGACTCTCCGCCCATCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443009    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016463.7-1371s21c1
Sequence:CCGGATTCTCTCACAGATTTCATTCCTCGAGGAATGAAATCTGTGAGAGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133687
VALIDATED
CXXC5 MISSION shRNA Bacterial Glycerol Stock
CXXC finger protein 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_133687.2-1770s1c2
Sequence:CCGGCCAACCATGAAATAGTGCATACTCGAGTATGCACTATTTCATGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_133687.2-1261s1c1
Sequence:CCGGTTCCGGTGGTTTCAGTGATTTCTCGAGAAATCACTGAAACCACCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_133687.2-1167s1c1
Sequence:CCGGTGGCCATCAGATTTGCAAATTCTCGAGAATTTGCAAATCTGATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133687.2-648s1c1
Sequence:CCGGCCTATTGGCCAATGGTCATGACTCGAGTCATGACCATTGGCCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_133687.2-495s1c1
Sequence:CCGGTCGGAACAAGAGCGGTATCATCTCGAGATGATACCGCTCTTGTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133687.2-1459s21c1
Sequence:CCGGTCTCCACGTCCCTAGTATAAACTCGAGTTTATACTAGGGACGTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133687.2-1262s21c1
Sequence:CCGGTCCGGTGGTTTCAGTGATTTCCTCGAGGAAATCACTGAAACCACCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133687.2-494s21c1
Sequence:CCGGGTCGGAACAAGAGCGGTATCACTCGAGTGATACCGCTCTTGTTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133687.2-1145s21c1
Sequence:CCGGGCAGTTGTAGGAACCGAAAGACTCGAGTCTTTCGGTTCCTACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133687.2-1167s21c1
Sequence:CCGGTGGCCATCAGATTTGCAAATTCTCGAGAATTTGCAAATCTGATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133687
VALIDATED
CXXC5 MISSION shRNA shRNA Plasmid DNA
CXXC finger protein 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_133687.2-1770s1c2
Sequence:CCGGCCAACCATGAAATAGTGCATACTCGAGTATGCACTATTTCATGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_133687.2-1261s1c1
Sequence:CCGGTTCCGGTGGTTTCAGTGATTTCTCGAGAAATCACTGAAACCACCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_133687.2-1167s1c1
Sequence:CCGGTGGCCATCAGATTTGCAAATTCTCGAGAATTTGCAAATCTGATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133687.2-648s1c1
Sequence:CCGGCCTATTGGCCAATGGTCATGACTCGAGTCATGACCATTGGCCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_133687.2-495s1c1
Sequence:CCGGTCGGAACAAGAGCGGTATCATCTCGAGATGATACCGCTCTTGTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133687.2-1459s21c1
Sequence:CCGGTCTCCACGTCCCTAGTATAAACTCGAGTTTATACTAGGGACGTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133687.2-1262s21c1
Sequence:CCGGTCCGGTGGTTTCAGTGATTTCCTCGAGGAAATCACTGAAACCACCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133687.2-494s21c1
Sequence:CCGGGTCGGAACAAGAGCGGTATCACTCGAGTGATACCGCTCTTGTTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133687.2-1145s21c1
Sequence:CCGGGCAGTTGTAGGAACCGAAAGACTCGAGTCTTTCGGTTCCTACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133687.2-1167s21c1
Sequence:CCGGTGGCCATCAGATTTGCAAATTCTCGAGAATTTGCAAATCTGATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133687
VALIDATED
CXXC5 MISSION shRNA Lentiviral Transduction Particles
CXXC finger protein 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193084    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_133687.2-1770s1c2
Sequence:CCGGCCAACCATGAAATAGTGCATACTCGAGTATGCACTATTTCATGGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_133687.2-1261s1c1
Sequence:CCGGTTCCGGTGGTTTCAGTGATTTCTCGAGAAATCACTGAAACCACCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_133687.2-1167s1c1
Sequence:CCGGTGGCCATCAGATTTGCAAATTCTCGAGAATTTGCAAATCTGATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219527    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133687.2-648s1c1
Sequence:CCGGCCTATTGGCCAATGGTCATGACTCGAGTCATGACCATTGGCCAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_133687.2-495s1c1
Sequence:CCGGTCGGAACAAGAGCGGTATCATCTCGAGATGATACCGCTCTTGTTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322450    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133687.2-1459s21c1
Sequence:CCGGTCTCCACGTCCCTAGTATAAACTCGAGTTTATACTAGGGACGTGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133687.2-1262s21c1
Sequence:CCGGTCCGGTGGTTTCAGTGATTTCCTCGAGGAAATCACTGAAACCACCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133687.2-494s21c1
Sequence:CCGGGTCGGAACAAGAGCGGTATCACTCGAGTGATACCGCTCTTGTTCCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133687.2-1145s21c1
Sequence:CCGGGCAGTTGTAGGAACCGAAAGACTCGAGTCTTTCGGTTCCTACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133687.2-1167s21c1
Sequence:CCGGTGGCCATCAGATTTGCAAATTCTCGAGAATTTGCAAATCTGATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks