EMAIL THIS PAGE TO A FRIEND

CXorf21

chromosome X open reading frame 21

Species: Human CXorf21(80231)
UniProtKB ID: Q9HAI6
Gene ID:
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025159 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025159 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025159 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045131 MISSION® esiRNA esiRNA human CXorf21 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025159 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025159 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208870 predicted 422
2 SASI_Hs02_00357912 predicted 743
3 SASI_Hs01_00208871 predicted 878
4 SASI_Hs01_00208872 predicted 373
5 SASI_Hs02_00357913 predicted 1034
6 SASI_Hs01_00208874 predicted 991
7 SASI_Hs01_00208875 predicted 456
8 SASI_Hs01_00208876 predicted 280
9 SASI_Hs01_00208878 predicted 1160
10 SASI_Hs01_00208879 predicted 1156
11 SASI_Hs01_00208873 predicted 935
12 SASI_Hs01_00208877 predicted 750
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025159
CXorf21 MISSION shRNA Bacterial Glycerol Stock
chromosome X open reading frame 21
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025159.1-671s1c1
Sequence:CCGGGCCAGGTGATGGCCATTAATTCTCGAGAATTAATGGCCATCACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025159.1-1136s1c1
Sequence:CCGGGCACTCCTAGTCTCCATATTTCTCGAGAAATATGGAGACTAGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025159.1-380s1c1
Sequence:CCGGCAAATTCTGTTGCTACCCTTTCTCGAGAAAGGGTAGCAACAGAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025159.1-450s1c1
Sequence:CCGGCAAATCATCTGGCAAGTTTATCTCGAGATAAACTTGCCAGATGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025159.1-605s1c1
Sequence:CCGGCCTACTTGGTTCCATCTTCTTCTCGAGAAGAAGATGGAACCAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025159.1-444s1c1
Sequence:CCGGGAGCTGCAAATCATCTGGCAACTCGAGTTGCCAGATGATTTGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025159.1-998s1c1
Sequence:CCGGCGTCTGAACTCATCATGACAACTCGAGTTGTCATGATGAGTTCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165215    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025159.1-1190s1c1
Sequence:CCGGGCTTCCATTACTGTCTCGCATCTCGAGATGCGAGACAGTAATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025159.2-992s21c1
Sequence:CCGGGCAAATGCAGAATCCTATTTCCTCGAGGAAATAGGATTCTGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025159.2-568s21c1
Sequence:CCGGGCAAATCATCTGGCAAGTTTACTCGAGTAAACTTGCCAGATGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025159.2-1203s21c1
Sequence:CCGGATAGTCTTTAGCCGCCTATTGCTCGAGCAATAGGCGGCTAAAGACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025159.2-1069s21c1
Sequence:CCGGACATTATGGACACCGTGTTTCCTCGAGGAAACACGGTGTCCATAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025159
CXorf21 MISSION shRNA shRNA Plasmid DNA
chromosome X open reading frame 21
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025159.1-671s1c1
Sequence:CCGGGCCAGGTGATGGCCATTAATTCTCGAGAATTAATGGCCATCACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025159.1-1136s1c1
Sequence:CCGGGCACTCCTAGTCTCCATATTTCTCGAGAAATATGGAGACTAGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025159.1-380s1c1
Sequence:CCGGCAAATTCTGTTGCTACCCTTTCTCGAGAAAGGGTAGCAACAGAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025159.1-450s1c1
Sequence:CCGGCAAATCATCTGGCAAGTTTATCTCGAGATAAACTTGCCAGATGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025159.1-605s1c1
Sequence:CCGGCCTACTTGGTTCCATCTTCTTCTCGAGAAGAAGATGGAACCAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025159.1-444s1c1
Sequence:CCGGGAGCTGCAAATCATCTGGCAACTCGAGTTGCCAGATGATTTGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025159.1-998s1c1
Sequence:CCGGCGTCTGAACTCATCATGACAACTCGAGTTGTCATGATGAGTTCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165215    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025159.1-1190s1c1
Sequence:CCGGGCTTCCATTACTGTCTCGCATCTCGAGATGCGAGACAGTAATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025159.2-992s21c1
Sequence:CCGGGCAAATGCAGAATCCTATTTCCTCGAGGAAATAGGATTCTGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025159.2-568s21c1
Sequence:CCGGGCAAATCATCTGGCAAGTTTACTCGAGTAAACTTGCCAGATGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025159.2-1203s21c1
Sequence:CCGGATAGTCTTTAGCCGCCTATTGCTCGAGCAATAGGCGGCTAAAGACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025159.2-1069s21c1
Sequence:CCGGACATTATGGACACCGTGTTTCCTCGAGGAAACACGGTGTCCATAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025159
CXorf21 MISSION shRNA Lentiviral Transduction Particles
chromosome X open reading frame 21
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025159.1-671s1c1
Sequence:CCGGGCCAGGTGATGGCCATTAATTCTCGAGAATTAATGGCCATCACCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161682    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025159.1-1136s1c1
Sequence:CCGGGCACTCCTAGTCTCCATATTTCTCGAGAAATATGGAGACTAGGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159462    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025159.1-380s1c1
Sequence:CCGGCAAATTCTGTTGCTACCCTTTCTCGAGAAAGGGTAGCAACAGAATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025159.1-450s1c1
Sequence:CCGGCAAATCATCTGGCAAGTTTATCTCGAGATAAACTTGCCAGATGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025159.1-605s1c1
Sequence:CCGGCCTACTTGGTTCCATCTTCTTCTCGAGAAGAAGATGGAACCAAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165632    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025159.1-444s1c1
Sequence:CCGGGAGCTGCAAATCATCTGGCAACTCGAGTTGCCAGATGATTTGCAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162745    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025159.1-998s1c1
Sequence:CCGGCGTCTGAACTCATCATGACAACTCGAGTTGTCATGATGAGTTCAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165215    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025159.1-1190s1c1
Sequence:CCGGGCTTCCATTACTGTCTCGCATCTCGAGATGCGAGACAGTAATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025159.2-992s21c1
Sequence:CCGGGCAAATGCAGAATCCTATTTCCTCGAGGAAATAGGATTCTGCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025159.2-568s21c1
Sequence:CCGGGCAAATCATCTGGCAAGTTTACTCGAGTAAACTTGCCAGATGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025159.2-1203s21c1
Sequence:CCGGATAGTCTTTAGCCGCCTATTGCTCGAGCAATAGGCGGCTAAAGACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420091    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025159.2-1069s21c1
Sequence:CCGGACATTATGGACACCGTGTTTCCTCGAGGAAACACGGTGTCCATAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks