EMAIL THIS PAGE TO A FRIEND

CXorf22

chromosome X open reading frame 22

24 Gene Product Result for
Species: Human CXorf22(170063)
UniProtKB ID: Q6ZTR5, Q5JRM8, Q8N6X8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301378 ANTI-CXORF22 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152632 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152632 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152632 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU062521 MISSION® esiRNA esiRNA human CXorf22 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152632 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230911 predicted 2608
2 SASI_Hs01_00230912 predicted 558
3 SASI_Hs01_00230913 predicted 635
4 SASI_Hs02_00366496 predicted 2708
5 SASI_Hs02_00366497 predicted 694
6 SASI_Hs01_00230915 predicted 1529
7 SASI_Hs02_00366498 predicted 2690
8 SASI_Hs01_00230916 predicted 3009
9 SASI_Hs01_00230917 predicted 2949
10 SASI_Hs01_00230918 predicted 1120
11 SASI_Hs01_00230909 predicted 2405
12 SASI_Hs01_00230910 predicted 1496
13 SASI_Hs01_00230914 predicted 605
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152632
CXorf22 MISSION shRNA Bacterial Glycerol Stock
chromosome X open reading frame 22
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152632.1-698s1c1
Sequence:CCGGGAGATGCTCTTGAGTATCAAACTCGAGTTTGATACTCAAGAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152632.1-371s1c1
Sequence:CCGGCGGCTACTTATTTCAATAGAACTCGAGTTCTATTGAAATAAGTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152632.1-1679s1c1
Sequence:CCGGCGCAAGAATTATGCACCTGTACTCGAGTACAGGTGCATAATTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152632.1-1753s1c1
Sequence:CCGGGCCAGTGAAGGATATGCTATTCTCGAGAATAGCATATCCTTCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152632.1-2229s1c1
Sequence:CCGGGCAGCTTAATGTTGACACCAACTCGAGTTGGTGTCAACATTAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152632
CXorf22 MISSION shRNA shRNA Plasmid DNA
chromosome X open reading frame 22
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152632.1-698s1c1
Sequence:CCGGGAGATGCTCTTGAGTATCAAACTCGAGTTTGATACTCAAGAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152632.1-371s1c1
Sequence:CCGGCGGCTACTTATTTCAATAGAACTCGAGTTCTATTGAAATAAGTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152632.1-1679s1c1
Sequence:CCGGCGCAAGAATTATGCACCTGTACTCGAGTACAGGTGCATAATTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152632.1-1753s1c1
Sequence:CCGGGCCAGTGAAGGATATGCTATTCTCGAGAATAGCATATCCTTCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152632.1-2229s1c1
Sequence:CCGGGCAGCTTAATGTTGACACCAACTCGAGTTGGTGTCAACATTAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152632
CXorf22 MISSION shRNA Lentiviral Transduction Particles
chromosome X open reading frame 22
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167652    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152632.1-698s1c1
Sequence:CCGGGAGATGCTCTTGAGTATCAAACTCGAGTTTGATACTCAAGAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152632.1-371s1c1
Sequence:CCGGCGGCTACTTATTTCAATAGAACTCGAGTTCTATTGAAATAAGTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152632.1-1679s1c1
Sequence:CCGGCGCAAGAATTATGCACCTGTACTCGAGTACAGGTGCATAATTCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152632.1-1753s1c1
Sequence:CCGGGCCAGTGAAGGATATGCTATTCTCGAGAATAGCATATCCTTCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152632.1-2229s1c1
Sequence:CCGGGCAGCTTAATGTTGACACCAACTCGAGTTGGTGTCAACATTAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks