EMAIL THIS PAGE TO A FRIEND

CXorf23

chromosome X open reading frame 23

Species: Human CXorf23(256643)
UniProtKB ID: A2AJT9, A1A4E8, Q5VSM7, Q5VSN1, Q6ZS60, Q8N1W7
Gene ID:
131 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA027215 Anti-CXorf23 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198279 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090621 MISSION® esiRNA esiRNA human CXorf23 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198279 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371832 predicted 1153
2 SASI_Hs02_00371833 predicted 1143
3 SASI_Hs02_00371834 predicted 654
4 SASI_Hs01_00019166 predicted 1646
5 SASI_Hs02_00371835 predicted 338
6 SASI_Hs02_00371836 predicted 1304
7 SASI_Hs02_00371837 predicted 603
8 SASI_Hs02_00371838 predicted 1041
9 SASI_Hs02_00371839 predicted 1220
10 SASI_Hs02_00371840 predicted 595
11 SASI_Hs01_00019162 predicted 966
12 SASI_Hs01_00019163 predicted 1504
13 SASI_Hs01_00019164 predicted 1108
14 SASI_Hs01_00019165 predicted 1522
15 SASI_Hs01_00019167 predicted 976
16 SASI_Hs01_00019168 predicted 1360
17 SASI_Hs01_00019169 predicted 1393
18 SASI_Hs01_00019170 predicted 1756
19 SASI_Hs01_00019171 predicted 1283
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198279
VALIDATED
CXorf23 MISSION shRNA Bacterial Glycerol Stock
chromosome X open reading frame 23
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_198279.1-1636s1c1
Sequence:CCGGCAGGCTAAGTATCAGCGTTTACTCGAGTAAACGCTGATACTTAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198279.1-1089s1c1
Sequence:CCGGCATTACTTTACATGAGCGTTTCTCGAGAAACGCTCATGTAAAGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198279.1-2578s1c1
Sequence:CCGGGCACATCTTATAGAGTGTTTACTCGAGTAAACACTCTATAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198279.1-1222s1c1
Sequence:CCGGGCTGTGATCTATGAATCGGAACTCGAGTTCCGATTCATAGATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_198279.1-1201s1c1
Sequence:CCGGGCCGAGCTTCAGAGTAAACAACTCGAGTTGTTTACTCTGAAGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198279.2-279s21c1
Sequence:CCGGTAAGCCTCACAGAGGATATTCCTCGAGGAATATCCTCTGTGAGGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198279.2-241s21c1
Sequence:CCGGCCTAACATAAGAAACTCTTTACTCGAGTAAAGAGTTTCTTATGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198279.2-1042s21c1
Sequence:CCGGGACAGCATTGCCTGTACTTATCTCGAGATAAGTACAGGCAATGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198279.2-612s21c1
Sequence:CCGGGTATCCTGAGGATCGTGATTTCTCGAGAAATCACGATCCTCAGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198279.2-2046s21c1
Sequence:CCGGCTAATCTGAAATCGTACAAATCTCGAGATTTGTACGATTTCAGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198279.2-824s21c1
Sequence:CCGGCCAAAGTATCCTATGACTATCCTCGAGGATAGTCATAGGATACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198279.2-2127s21c1
Sequence:CCGGGTGACACTAAGGCACTAATACCTCGAGGTATTAGTGCCTTAGTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198279
VALIDATED
CXorf23 MISSION shRNA shRNA Plasmid DNA
chromosome X open reading frame 23
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_198279.1-1636s1c1
Sequence:CCGGCAGGCTAAGTATCAGCGTTTACTCGAGTAAACGCTGATACTTAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198279.1-1089s1c1
Sequence:CCGGCATTACTTTACATGAGCGTTTCTCGAGAAACGCTCATGTAAAGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198279.1-2578s1c1
Sequence:CCGGGCACATCTTATAGAGTGTTTACTCGAGTAAACACTCTATAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198279.1-1222s1c1
Sequence:CCGGGCTGTGATCTATGAATCGGAACTCGAGTTCCGATTCATAGATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_198279.1-1201s1c1
Sequence:CCGGGCCGAGCTTCAGAGTAAACAACTCGAGTTGTTTACTCTGAAGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198279.2-279s21c1
Sequence:CCGGTAAGCCTCACAGAGGATATTCCTCGAGGAATATCCTCTGTGAGGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198279.2-241s21c1
Sequence:CCGGCCTAACATAAGAAACTCTTTACTCGAGTAAAGAGTTTCTTATGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198279.2-1042s21c1
Sequence:CCGGGACAGCATTGCCTGTACTTATCTCGAGATAAGTACAGGCAATGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198279.2-612s21c1
Sequence:CCGGGTATCCTGAGGATCGTGATTTCTCGAGAAATCACGATCCTCAGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198279.2-2046s21c1
Sequence:CCGGCTAATCTGAAATCGTACAAATCTCGAGATTTGTACGATTTCAGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198279.2-824s21c1
Sequence:CCGGCCAAAGTATCCTATGACTATCCTCGAGGATAGTCATAGGATACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198279.2-2127s21c1
Sequence:CCGGGTGACACTAAGGCACTAATACCTCGAGGTATTAGTGCCTTAGTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198279
VALIDATED
CXorf23 MISSION shRNA Lentiviral Transduction Particles
chromosome X open reading frame 23
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_198279.1-1636s1c1
Sequence:CCGGCAGGCTAAGTATCAGCGTTTACTCGAGTAAACGCTGATACTTAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198279.1-1089s1c1
Sequence:CCGGCATTACTTTACATGAGCGTTTCTCGAGAAACGCTCATGTAAAGTAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107515    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198279.1-2578s1c1
Sequence:CCGGGCACATCTTATAGAGTGTTTACTCGAGTAAACACTCTATAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198279.1-1222s1c1
Sequence:CCGGGCTGTGATCTATGAATCGGAACTCGAGTTCCGATTCATAGATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_198279.1-1201s1c1
Sequence:CCGGGCCGAGCTTCAGAGTAAACAACTCGAGTTGTTTACTCTGAAGCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198279.2-279s21c1
Sequence:CCGGTAAGCCTCACAGAGGATATTCCTCGAGGAATATCCTCTGTGAGGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198279.2-241s21c1
Sequence:CCGGCCTAACATAAGAAACTCTTTACTCGAGTAAAGAGTTTCTTATGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198279.2-1042s21c1
Sequence:CCGGGACAGCATTGCCTGTACTTATCTCGAGATAAGTACAGGCAATGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198279.2-612s21c1
Sequence:CCGGGTATCCTGAGGATCGTGATTTCTCGAGAAATCACGATCCTCAGGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198279.2-2046s21c1
Sequence:CCGGCTAATCTGAAATCGTACAAATCTCGAGATTTGTACGATTTCAGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198279.2-824s21c1
Sequence:CCGGCCAAAGTATCCTATGACTATCCTCGAGGATAGTCATAGGATACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432119    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198279.2-2127s21c1
Sequence:CCGGGTGACACTAAGGCACTAATACCTCGAGGTATTAGTGCCTTAGTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks