EMAIL THIS PAGE TO A FRIEND

CXorf27

chromosome X open reading frame 27

25 Gene Product Result for
Synonyms: HIP17 HYPM
Species: Human CXorf27(25763)
UniProtKB ID: O75409, A1A4D3
Gene ID:
Human(25763) Summary: This gene encodes a protein shown to interact with huntingtin, which contains an expanded polyglutamine tract in individuals with Huntington's disease (PMID: 9700202). [provided by RefSeq, Aug 2011]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012274 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012274 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012274 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058651 MISSION® esiRNA esiRNA human CXorf27 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012274 Rosetta Predictions human pricing
XM_048235 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343997 predicted 242
2 SASI_Hs02_00343998 predicted 254
3 SASI_Hs02_00343999 predicted 219
4 SASI_Hs02_00344000 predicted 253
5 SASI_Hs02_00344001 predicted 250
6 SASI_Hs02_00344002 predicted 274
7 SASI_Hs02_00344003 predicted 213
8 SASI_Hs02_00344004 predicted 241
9 SASI_Hs02_00344005 predicted 272
10 SASI_Hs02_00344006 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_048235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00281694 predicted 322
2 SASI_Hs01_00281695 predicted 329
3 SASI_Hs01_00281696 predicted 331
4 SASI_Hs01_00281697 predicted 301
5 SASI_Hs01_00281698 predicted 326
6 SASI_Hs01_00281699 predicted 329
7 SASI_Hs01_00281700 predicted 330
8 SASI_Hs01_00281701 predicted 294
9 SASI_Hs01_00281702 predicted 326
10 SASI_Hs01_00281703 predicted 350
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012274
CXorf27 MISSION shRNA Bacterial Glycerol Stock
chromosome X open reading frame 27
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012274.1-341s21c1
Sequence:CCGGGTTTGATGAGATGCCCAAATCCTCGAGGATTTGGGCATCTCATCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012274.1-179s21c1
Sequence:CCGGCCTCCTTACCTTGCTCGATTGCTCGAGCAATCGAGCAAGGTAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012274.1-155s21c1
Sequence:CCGGCCAGAGTTCCTCCACAATAAACTCGAGTTTATTGTGGAGGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012274.1-72s21c1
Sequence:CCGGACTCAAGACCCTTCTAGAAATCTCGAGATTTCTAGAAGGGTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012274.1-257s21c1
Sequence:CCGGGCGCAACACTTCACAAGATAGCTCGAGCTATCTTGTGAAGTGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012274
CXorf27 MISSION shRNA shRNA Plasmid DNA
chromosome X open reading frame 27
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012274.1-341s21c1
Sequence:CCGGGTTTGATGAGATGCCCAAATCCTCGAGGATTTGGGCATCTCATCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012274.1-179s21c1
Sequence:CCGGCCTCCTTACCTTGCTCGATTGCTCGAGCAATCGAGCAAGGTAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012274.1-155s21c1
Sequence:CCGGCCAGAGTTCCTCCACAATAAACTCGAGTTTATTGTGGAGGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012274.1-72s21c1
Sequence:CCGGACTCAAGACCCTTCTAGAAATCTCGAGATTTCTAGAAGGGTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012274.1-257s21c1
Sequence:CCGGGCGCAACACTTCACAAGATAGCTCGAGCTATCTTGTGAAGTGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012274
CXorf27 MISSION shRNA Lentiviral Transduction Particles
chromosome X open reading frame 27
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012274.1-341s21c1
Sequence:CCGGGTTTGATGAGATGCCCAAATCCTCGAGGATTTGGGCATCTCATCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012274.1-179s21c1
Sequence:CCGGCCTCCTTACCTTGCTCGATTGCTCGAGCAATCGAGCAAGGTAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012274.1-155s21c1
Sequence:CCGGCCAGAGTTCCTCCACAATAAACTCGAGTTTATTGTGGAGGAACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012274.1-72s21c1
Sequence:CCGGACTCAAGACCCTTCTAGAAATCTCGAGATTTCTAGAAGGGTCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012274.1-257s21c1
Sequence:CCGGGCGCAACACTTCACAAGATAGCTCGAGCTATCTTGTGAAGTGTTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks