EMAIL THIS PAGE TO A FRIEND

CXorf30

chromosome X open reading frame 30

75 Gene Product Result for
UniProtKB ID: A6PW82
Gene ID:
chicken(771887) chromosome 1 open reading frame, human CXorf30
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301278 ANTI-CXORF30 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001098843 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001098843 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001098843 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098843 Rosetta Predictions human pricing
XM_001713662 Rosetta Predictions human pricing
XM_001713663 Rosetta Predictions human pricing
XM_001713664 Rosetta Predictions human pricing
XM_098980 Rosetta Predictions human pricing
XM_934162 Rosetta Predictions human pricing
XM_934165 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098843 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320164 predicted 1915
2 SASI_Hs02_00320165 predicted 917
3 SASI_Hs02_00320166 predicted 1029
4 SASI_Hs02_00320167 predicted 1351
5 SASI_Hs02_00320168 predicted 1089
6 SASI_Hs02_00320169 predicted 1226
7 SASI_Hs02_00320170 predicted 2308
8 SASI_Hs02_00320171 predicted 1616
9 SASI_Hs02_00320172 predicted 980
10 SASI_Hs02_00320173 predicted 1121
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00392563 predicted 1018
2 SASI_Hs02_00392564 predicted 451
3 SASI_Hs02_00392565 predicted 331
4 SASI_Hs02_00392566 predicted 503
5 SASI_Hs02_00392567 predicted 466
6 SASI_Hs02_00392568 predicted 718
7 SASI_Hs02_00392569 predicted 439
8 SASI_Hs02_00392570 predicted 222
9 SASI_Hs02_00392571 predicted 780
10 SASI_Hs02_00392572 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713663 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00392573 predicted 1018
2 SASI_Hs02_00392574 predicted 448
3 SASI_Hs02_00392575 predicted 335
4 SASI_Hs02_00392576 predicted 499
5 SASI_Hs02_00392577 predicted 461
6 SASI_Hs02_00392578 predicted 722
7 SASI_Hs02_00392579 predicted 437
8 SASI_Hs02_00392580 predicted 220
9 SASI_Hs02_00392581 predicted 786
10 SASI_Hs02_00392582 predicted 940
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001713664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00392583 predicted 1017
2 SASI_Hs02_00392584 predicted 450
3 SASI_Hs02_00392585 predicted 333
4 SASI_Hs02_00392586 predicted 501
5 SASI_Hs02_00392587 predicted 464
6 SASI_Hs02_00392588 predicted 720
7 SASI_Hs02_00392589 predicted 442
8 SASI_Hs02_00392590 predicted 229
9 SASI_Hs02_00392591 predicted 787
10 SASI_Hs02_00392592 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_098980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00300401 predicted 1318
2 SASI_Hs01_00300402 predicted 569
3 SASI_Hs01_00300403 predicted 318
4 SASI_Hs01_00300404 predicted 434
5 SASI_Hs01_00300405 predicted 553
6 SASI_Hs01_00300406 predicted 750
7 SASI_Hs01_00300407 predicted 503
8 SASI_Hs01_00300408 predicted 1712
9 SASI_Hs01_00300409 predicted 1021
10 SASI_Hs01_00300410 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264819 predicted 1327
2 SASI_Hs01_00264820 predicted 565
3 SASI_Hs01_00264821 predicted 322
4 SASI_Hs01_00264822 predicted 437
5 SASI_Hs01_00264823 predicted 555
6 SASI_Hs01_00264824 predicted 754
7 SASI_Hs01_00264825 predicted 500
8 SASI_Hs01_00264826 predicted 1018
9 SASI_Hs01_00264827 predicted 1459
10 SASI_Hs01_00264828 predicted 391
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00268826 predicted 528
2 SASI_Hs01_00268827 predicted 531
3 SASI_Hs01_00268828 predicted 584
4 SASI_Hs01_00268829 predicted 333
5 SASI_Hs01_00268830 predicted 571
6 SASI_Hs01_00268831 predicted 649
7 SASI_Hs01_00268832 predicted 317
8 SASI_Hs01_00268833 predicted 576
9 SASI_Hs01_00268834 predicted 566
10 SASI_Hs01_00268835 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001098843
CXorf30 MISSION shRNA Bacterial Glycerol Stock
chromosome X open reading frame 30
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098843.3-1618s21c1
Sequence:CCGGCAAGCAATACACTGGATATACCTCGAGGTATATCCAGTGTATTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098843.3-1195s21c1
Sequence:CCGGTTATCTGGAGTAGGACTATTTCTCGAGAAATAGTCCTACTCCAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098843.3-1596s21c1
Sequence:CCGGGGGAATCGACAGCGAAGAAATCTCGAGATTTCTTCGCTGTCGATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098843.3-1252s21c1
Sequence:CCGGATTGGTCTTCAGTCAACTATTCTCGAGAATAGTTGACTGAAGACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098843.3-2582s21c1
Sequence:CCGGGTAGAACTTTGATGACTATTACTCGAGTAATAGTCATCAAAGTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001098843
CXorf30 MISSION shRNA shRNA Plasmid DNA
chromosome X open reading frame 30
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098843.3-1618s21c1
Sequence:CCGGCAAGCAATACACTGGATATACCTCGAGGTATATCCAGTGTATTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098843.3-1195s21c1
Sequence:CCGGTTATCTGGAGTAGGACTATTTCTCGAGAAATAGTCCTACTCCAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098843.3-1596s21c1
Sequence:CCGGGGGAATCGACAGCGAAGAAATCTCGAGATTTCTTCGCTGTCGATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098843.3-1252s21c1
Sequence:CCGGATTGGTCTTCAGTCAACTATTCTCGAGAATAGTTGACTGAAGACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098843.3-2582s21c1
Sequence:CCGGGTAGAACTTTGATGACTATTACTCGAGTAATAGTCATCAAAGTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001098843
CXorf30 MISSION shRNA Lentiviral Transduction Particles
chromosome X open reading frame 30
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098843.3-1618s21c1
Sequence:CCGGCAAGCAATACACTGGATATACCTCGAGGTATATCCAGTGTATTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098843.3-1195s21c1
Sequence:CCGGTTATCTGGAGTAGGACTATTTCTCGAGAAATAGTCCTACTCCAGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098843.3-1596s21c1
Sequence:CCGGGGGAATCGACAGCGAAGAAATCTCGAGATTTCTTCGCTGTCGATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001098843.3-1252s21c1
Sequence:CCGGATTGGTCTTCAGTCAACTATTCTCGAGAATAGTTGACTGAAGACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001098843.3-2582s21c1
Sequence:CCGGGTAGAACTTTGATGACTATTACTCGAGTAATAGTCATCAAAGTTCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks