EMAIL THIS PAGE TO A FRIEND

CXorf36

chromosome X open reading frame 36

50 Gene Product Result for
Synonyms: 4930578C19Rik DIA1R EPQL1862 PRO3743 bA435K1.1
Species: Human CXorf36(79742)
UniProtKB ID: Q9H7Y0, A8MUU5, B2RPN7, Q6UWJ5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024689 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024689 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024689 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024689 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357134 predicted 674
2 SASI_Hs01_00208821 predicted 795
3 SASI_Hs01_00208822 predicted 220
4 SASI_Hs01_00208823 predicted 257
5 SASI_Hs02_00357135 predicted 677
6 SASI_Hs01_00208825 predicted 230
7 SASI_Hs01_00208826 predicted 410
8 SASI_Hs01_00208828 predicted 687
9 SASI_Hs02_00357136 predicted 413
10 SASI_Hs01_00208829 predicted 404
11 SASI_Hs01_00208820 predicted 345
12 SASI_Hs01_00208824 predicted 642
13 SASI_Hs01_00208827 predicted 271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024689
CXorf36 MISSION shRNA Bacterial Glycerol Stock
chromosome X open reading frame 36
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024689.2-415s21c1
Sequence:CCGGTTTAGACTGGTCAGCAAATATCTCGAGATATTTGCTGACCAGTCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024689.2-204s21c1
Sequence:CCGGAGTCAGAACCAGCTACAATTTCTCGAGAAATTGTAGCTGGTTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024689.2-813s21c1
Sequence:CCGGAGGCTACCTTTGCACAATATTCTCGAGAATATTGTGCAAAGGTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024689.2-991s21c1
Sequence:CCGGTGATAAGGAGCTAGGGCAATTCTCGAGAATTGCCCTAGCTCCTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024689.1-237s1c1
Sequence:CCGGCCTCGGTCTTGATAAATGCAACTCGAGTTGCATTTATCAAGACCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024689.1-368s1c1
Sequence:CCGGCTGCAAATTACTCAGATGATTCTCGAGAATCATCTGAGTAATTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024689.1-150s1c1
Sequence:CCGGCCTGAGCTGTTCTTTCTCCTTCTCGAGAAGGAGAAAGAACAGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024689.1-344s1c1
Sequence:CCGGCTCCCGATTCCTTGCTTTCTTCTCGAGAAGAAAGCAAGGAATCGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024689
CXorf36 MISSION shRNA shRNA Plasmid DNA
chromosome X open reading frame 36
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024689.2-415s21c1
Sequence:CCGGTTTAGACTGGTCAGCAAATATCTCGAGATATTTGCTGACCAGTCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024689.2-204s21c1
Sequence:CCGGAGTCAGAACCAGCTACAATTTCTCGAGAAATTGTAGCTGGTTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024689.2-813s21c1
Sequence:CCGGAGGCTACCTTTGCACAATATTCTCGAGAATATTGTGCAAAGGTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024689.2-991s21c1
Sequence:CCGGTGATAAGGAGCTAGGGCAATTCTCGAGAATTGCCCTAGCTCCTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024689.1-237s1c1
Sequence:CCGGCCTCGGTCTTGATAAATGCAACTCGAGTTGCATTTATCAAGACCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024689.1-368s1c1
Sequence:CCGGCTGCAAATTACTCAGATGATTCTCGAGAATCATCTGAGTAATTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024689.1-150s1c1
Sequence:CCGGCCTGAGCTGTTCTTTCTCCTTCTCGAGAAGGAGAAAGAACAGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024689.1-344s1c1
Sequence:CCGGCTCCCGATTCCTTGCTTTCTTCTCGAGAAGAAAGCAAGGAATCGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024689
CXorf36 MISSION shRNA Lentiviral Transduction Particles
chromosome X open reading frame 36
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024689.2-415s21c1
Sequence:CCGGTTTAGACTGGTCAGCAAATATCTCGAGATATTTGCTGACCAGTCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024689.2-204s21c1
Sequence:CCGGAGTCAGAACCAGCTACAATTTCTCGAGAAATTGTAGCTGGTTCTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024689.2-813s21c1
Sequence:CCGGAGGCTACCTTTGCACAATATTCTCGAGAATATTGTGCAAAGGTAGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024689.2-991s21c1
Sequence:CCGGTGATAAGGAGCTAGGGCAATTCTCGAGAATTGCCCTAGCTCCTTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024689.1-237s1c1
Sequence:CCGGCCTCGGTCTTGATAAATGCAACTCGAGTTGCATTTATCAAGACCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024689.1-368s1c1
Sequence:CCGGCTGCAAATTACTCAGATGATTCTCGAGAATCATCTGAGTAATTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173070    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024689.1-150s1c1
Sequence:CCGGCCTGAGCTGTTCTTTCTCCTTCTCGAGAAGGAGAAAGAACAGCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024689.1-344s1c1
Sequence:CCGGCTCCCGATTCCTTGCTTTCTTCTCGAGAAGAAAGCAAGGAATCGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks