EMAIL THIS PAGE TO A FRIEND

CXorf38

chromosome X open reading frame 38

Species: Human CXorf38(159013)
UniProtKB ID: Q8TB03, B3KW28, D3DWB5, Q5JPF5, Q8N941
Gene ID:
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144970 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144970 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144970 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075601 MISSION® esiRNA esiRNA human CXorf38 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144970 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144970 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011548 predicted 510
2 SASI_Hs01_00011549 predicted 592
3 SASI_Hs01_00011550 predicted 760
4 SASI_Hs01_00011551 predicted 496
5 SASI_Hs01_00011552 predicted 521
6 SASI_Hs01_00011553 predicted 810
7 SASI_Hs01_00011555 predicted 484
8 SASI_Hs01_00011556 predicted 848
9 SASI_Hs01_00011557 predicted 983
10 SASI_Hs02_00364762 predicted 836
11 SASI_Hs01_00011554 predicted 942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144970
CXorf38 MISSION shRNA Bacterial Glycerol Stock
chromosome X open reading frame 38
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144970.1-852s1c1
Sequence:CCGGGAGGATCTTAGAAATGGCCTTCTCGAGAAGGCCATTTCTAAGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144970.1-393s1c1
Sequence:CCGGCCTGAGGAATGTGATGCAGTTCTCGAGAACTGCATCACATTCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144970.1-806s1c1
Sequence:CCGGGCTCTCAAATCGACTGGAAGTCTCGAGACTTCCAGTCGATTTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140509    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144970.1-1013s1c1
Sequence:CCGGGCTTCCATCTCAGACATCCTTCTCGAGAAGGATGTCTGAGATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144970.1-399s1c1
Sequence:CCGGGAATGTGATGCAGTTGCTCTTCTCGAGAAGAGCAACTGCATCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143023    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144970.1-1014s1c1
Sequence:CCGGCTTCCATCTCAGACATCCTTTCTCGAGAAAGGATGTCTGAGATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144970.1-1058s1c1
Sequence:CCGGCAGAGTATTGTACCCAAACAACTCGAGTTGTTTGGGTACAATACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144970.1-603s1c1
Sequence:CCGGGCAGTATACTCCAGAATAGAACTCGAGTTCTATTCTGGAGTATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144970.1-490s1c1
Sequence:CCGGGTAATGAGATCATGCACTCTTCTCGAGAAGAGTGCATGATCTCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144970.1-1111s1c1
Sequence:CCGGCCTCTAACTCTTTGGAACTATCTCGAGATAGTTCCAAAGAGTTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144970.1-840s1c1
Sequence:CCGGCTGAGAAACAATGAGGATCTTCTCGAGAAGATCCTCATTGTTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144970.1-682s1c1
Sequence:CCGGGTGAATGTGAAATGGGAACTTCTCGAGAAGTTCCCATTTCACATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144970
CXorf38 MISSION shRNA shRNA Plasmid DNA
chromosome X open reading frame 38
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144970.1-852s1c1
Sequence:CCGGGAGGATCTTAGAAATGGCCTTCTCGAGAAGGCCATTTCTAAGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144970.1-393s1c1
Sequence:CCGGCCTGAGGAATGTGATGCAGTTCTCGAGAACTGCATCACATTCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144970.1-806s1c1
Sequence:CCGGGCTCTCAAATCGACTGGAAGTCTCGAGACTTCCAGTCGATTTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140509    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144970.1-1013s1c1
Sequence:CCGGGCTTCCATCTCAGACATCCTTCTCGAGAAGGATGTCTGAGATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144970.1-399s1c1
Sequence:CCGGGAATGTGATGCAGTTGCTCTTCTCGAGAAGAGCAACTGCATCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143023    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144970.1-1014s1c1
Sequence:CCGGCTTCCATCTCAGACATCCTTTCTCGAGAAAGGATGTCTGAGATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144970.1-1058s1c1
Sequence:CCGGCAGAGTATTGTACCCAAACAACTCGAGTTGTTTGGGTACAATACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144970.1-603s1c1
Sequence:CCGGGCAGTATACTCCAGAATAGAACTCGAGTTCTATTCTGGAGTATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144970.1-490s1c1
Sequence:CCGGGTAATGAGATCATGCACTCTTCTCGAGAAGAGTGCATGATCTCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144970.1-1111s1c1
Sequence:CCGGCCTCTAACTCTTTGGAACTATCTCGAGATAGTTCCAAAGAGTTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144970.1-840s1c1
Sequence:CCGGCTGAGAAACAATGAGGATCTTCTCGAGAAGATCCTCATTGTTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144970.1-682s1c1
Sequence:CCGGGTGAATGTGAAATGGGAACTTCTCGAGAAGTTCCCATTTCACATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144970
CXorf38 MISSION shRNA Lentiviral Transduction Particles
chromosome X open reading frame 38
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143560    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144970.1-852s1c1
Sequence:CCGGGAGGATCTTAGAAATGGCCTTCTCGAGAAGGCCATTTCTAAGATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144970.1-393s1c1
Sequence:CCGGCCTGAGGAATGTGATGCAGTTCTCGAGAACTGCATCACATTCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140216    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144970.1-806s1c1
Sequence:CCGGGCTCTCAAATCGACTGGAAGTCTCGAGACTTCCAGTCGATTTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140509    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144970.1-1013s1c1
Sequence:CCGGGCTTCCATCTCAGACATCCTTCTCGAGAAGGATGTCTGAGATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144970.1-399s1c1
Sequence:CCGGGAATGTGATGCAGTTGCTCTTCTCGAGAAGAGCAACTGCATCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143023    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_144970.1-1014s1c1
Sequence:CCGGCTTCCATCTCAGACATCCTTTCTCGAGAAAGGATGTCTGAGATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144970.1-1058s1c1
Sequence:CCGGCAGAGTATTGTACCCAAACAACTCGAGTTGTTTGGGTACAATACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144970.1-603s1c1
Sequence:CCGGGCAGTATACTCCAGAATAGAACTCGAGTTCTATTCTGGAGTATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144739    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144970.1-490s1c1
Sequence:CCGGGTAATGAGATCATGCACTCTTCTCGAGAAGAGTGCATGATCTCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144970.1-1111s1c1
Sequence:CCGGCCTCTAACTCTTTGGAACTATCTCGAGATAGTTCCAAAGAGTTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144970.1-840s1c1
Sequence:CCGGCTGAGAAACAATGAGGATCTTCTCGAGAAGATCCTCATTGTTTCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144970.1-682s1c1
Sequence:CCGGGTGAATGTGAAATGGGAACTTCTCGAGAAGTTCCCATTTCACATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks