EMAIL THIS PAGE TO A FRIEND

CXorf40A

chromosome X open reading frame 40A

83 Gene Product Result for
Synonyms: CXorf40 EOLA1
Species: Human CXorf40A(91966)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301123 ANTI-CXORF40A (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178124 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178124 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178124 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178124 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178124 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150492 predicted 979
2 SASI_Hs01_00150493 predicted 1109
3 SASI_Hs02_00369530 predicted 844
4 SASI_Hs02_00369531 predicted 886
5 SASI_Hs01_00150494 predicted 719
6 SASI_Hs01_00150495 predicted 552
7 SASI_Hs01_00150496 predicted 1081
8 SASI_Hs01_00150498 predicted 640
9 SASI_Hs01_00150499 predicted 1044
10 SASI_Hs02_00369532 predicted 843
11 SASI_Hs01_00150497 predicted 577
12 SASI_Hs01_00150500 predicted 634
13 SASI_Hs01_00150501 predicted 1034
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178124
VALIDATED
CXorf40A MISSION shRNA Bacterial Glycerol Stock
chromosome X open reading frame 40A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178124.3-1059s1c1
Sequence:CCGGGCTAAATCATGACACCTTCAACTCGAGTTGAAGGTGTCATGATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143994    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178124.3-1048s1c1
Sequence:CCGGCAGAGAAACCAGCTAAATCATCTCGAGATGATTTAGCTGGTTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178124.3-830s1c1
Sequence:CCGGCGAAGACTTAACTCCCGATGACTCGAGTCATCGGGAGTTAAGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178124.3-941s1c1
Sequence:CCGGCATACCTAGGAAAGGAGGCAACTCGAGTTGCCTCCTTTCCTAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178124.3-881s1c1
Sequence:CCGGGACCAACCTGAAGCAGAAGTACTCGAGTACTTCTGCTTCAGGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178124.3-572s1c1
Sequence:CCGGGCCTTATGCTGGCTTTGTCTTCTCGAGAAGACAAAGCCAGCATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178124.3-950s1c1
Sequence:CCGGGAAAGGAGGCAAGGATGTATTCTCGAGAATACATCCTTGCCTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178124.3-1056s1c1
Sequence:CCGGCCAGCTAAATCATGACACCTTCTCGAGAAGGTGTCATGATTTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122874    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178124.3-1044s1c1
Sequence:CCGGGTTCCAGAGAAACCAGCTAAACTCGAGTTTAGCTGGTTTCTCTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178124.3-1035s1c1
Sequence:CCGGGAAAGGAATGTTCCAGAGAAACTCGAGTTTCTCTGGAACATTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178124.3-893s1c1
Sequence:CCGGGCAGAAGTACCTGACTGTGATCTCGAGATCACAGTCAGGTACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178124
VALIDATED
CXorf40A MISSION shRNA shRNA Plasmid DNA
chromosome X open reading frame 40A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178124.3-1059s1c1
Sequence:CCGGGCTAAATCATGACACCTTCAACTCGAGTTGAAGGTGTCATGATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143994    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178124.3-1048s1c1
Sequence:CCGGCAGAGAAACCAGCTAAATCATCTCGAGATGATTTAGCTGGTTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178124.3-830s1c1
Sequence:CCGGCGAAGACTTAACTCCCGATGACTCGAGTCATCGGGAGTTAAGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178124.3-941s1c1
Sequence:CCGGCATACCTAGGAAAGGAGGCAACTCGAGTTGCCTCCTTTCCTAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178124.3-881s1c1
Sequence:CCGGGACCAACCTGAAGCAGAAGTACTCGAGTACTTCTGCTTCAGGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178124.3-572s1c1
Sequence:CCGGGCCTTATGCTGGCTTTGTCTTCTCGAGAAGACAAAGCCAGCATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178124.3-950s1c1
Sequence:CCGGGAAAGGAGGCAAGGATGTATTCTCGAGAATACATCCTTGCCTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178124.3-1056s1c1
Sequence:CCGGCCAGCTAAATCATGACACCTTCTCGAGAAGGTGTCATGATTTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122874    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178124.3-1044s1c1
Sequence:CCGGGTTCCAGAGAAACCAGCTAAACTCGAGTTTAGCTGGTTTCTCTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178124.3-1035s1c1
Sequence:CCGGGAAAGGAATGTTCCAGAGAAACTCGAGTTTCTCTGGAACATTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178124.3-893s1c1
Sequence:CCGGGCAGAAGTACCTGACTGTGATCTCGAGATCACAGTCAGGTACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178124
VALIDATED
CXorf40A MISSION shRNA Lentiviral Transduction Particles
chromosome X open reading frame 40A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144967    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178124.3-1059s1c1
Sequence:CCGGGCTAAATCATGACACCTTCAACTCGAGTTGAAGGTGTCATGATTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143994    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178124.3-1048s1c1
Sequence:CCGGCAGAGAAACCAGCTAAATCATCTCGAGATGATTTAGCTGGTTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139018    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178124.3-830s1c1
Sequence:CCGGCGAAGACTTAACTCCCGATGACTCGAGTCATCGGGAGTTAAGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139425    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178124.3-941s1c1
Sequence:CCGGCATACCTAGGAAAGGAGGCAACTCGAGTTGCCTCCTTTCCTAGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140173    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178124.3-881s1c1
Sequence:CCGGGACCAACCTGAAGCAGAAGTACTCGAGTACTTCTGCTTCAGGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178124.3-572s1c1
Sequence:CCGGGCCTTATGCTGGCTTTGTCTTCTCGAGAAGACAAAGCCAGCATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143181    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178124.3-950s1c1
Sequence:CCGGGAAAGGAGGCAAGGATGTATTCTCGAGAATACATCCTTGCCTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143862    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178124.3-1056s1c1
Sequence:CCGGCCAGCTAAATCATGACACCTTCTCGAGAAGGTGTCATGATTTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122874    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178124.3-1044s1c1
Sequence:CCGGGTTCCAGAGAAACCAGCTAAACTCGAGTTTAGCTGGTTTCTCTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178124.3-1035s1c1
Sequence:CCGGGAAAGGAATGTTCCAGAGAAACTCGAGTTTCTCTGGAACATTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_178124.3-893s1c1
Sequence:CCGGGCAGAAGTACCTGACTGTGATCTCGAGATCACAGTCAGGTACTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks