EMAIL THIS PAGE TO A FRIEND

CXorf40B

chromosome X open reading frame 40B

16 Gene Product Result for
Species: Human CXorf40B(541578)
UniProtKB ID: Q96DE9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013845 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013845 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013845 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013845 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013845 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170799 predicted 958
2 SASI_Hs01_00170800 predicted 815
3 SASI_Hs01_00170801 predicted 1057
4 SASI_Hs02_00306509 predicted 867
5 SASI_Hs01_00170803 predicted 697
6 SASI_Hs01_00170804 predicted 529
7 SASI_Hs01_00170805 predicted 1083
8 SASI_Hs01_00170806 predicted 1066
9 SASI_Hs01_00170807 predicted 1064
10 SASI_Hs02_00306510 predicted 1033
11 SASI_Hs01_00170802 predicted 828
12 SASI_Hs01_00170808 predicted 550
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013845
CXorf40B MISSION shRNA Bacterial Glycerol Stock
chromosome X open reading frame 40B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-804s1c1
Sequence:CCGGCGAAGACTTAACTCCCGATGACTCGAGTCATCGGGAGTTAAGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-868s1c1
Sequence:CCGGCAGAAGTACCTGACTGTGATTCTCGAGAATCACAGTCAGGTACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-820s1c1
Sequence:CCGGGATGAGGTTGTGGAACTAGAACTCGAGTTCTAGTTCCACAACCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-873s1c1
Sequence:CCGGGTACCTGACTGTGATTTCAAACTCGAGTTTGAAATCACAGTCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-557s1c1
Sequence:CCGGGCTTTGTCTTAAATGGAATCACTCGAGTGATTCCATTTAAGACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-924s1c1
Sequence:CCGGGAAAGGAGGCAAGGATGTATTCTCGAGAATACATCCTTGCCTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-933s1c1
Sequence:CCGGCAAGGATGTATTCCAGGTAGACTCGAGTCTACCTGGAATACATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-855s1c1
Sequence:CCGGGACCAACCTGAAGCAGAAGTACTCGAGTACTTCTGCTTCAGGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-546s1c1
Sequence:CCGGGCCTTATGCTGGCTTTGTCTTCTCGAGAAGACAAAGCCAGCATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013845
CXorf40B MISSION shRNA shRNA Plasmid DNA
chromosome X open reading frame 40B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-804s1c1
Sequence:CCGGCGAAGACTTAACTCCCGATGACTCGAGTCATCGGGAGTTAAGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-868s1c1
Sequence:CCGGCAGAAGTACCTGACTGTGATTCTCGAGAATCACAGTCAGGTACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-820s1c1
Sequence:CCGGGATGAGGTTGTGGAACTAGAACTCGAGTTCTAGTTCCACAACCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-873s1c1
Sequence:CCGGGTACCTGACTGTGATTTCAAACTCGAGTTTGAAATCACAGTCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-557s1c1
Sequence:CCGGGCTTTGTCTTAAATGGAATCACTCGAGTGATTCCATTTAAGACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-924s1c1
Sequence:CCGGGAAAGGAGGCAAGGATGTATTCTCGAGAATACATCCTTGCCTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-933s1c1
Sequence:CCGGCAAGGATGTATTCCAGGTAGACTCGAGTCTACCTGGAATACATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-855s1c1
Sequence:CCGGGACCAACCTGAAGCAGAAGTACTCGAGTACTTCTGCTTCAGGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-546s1c1
Sequence:CCGGGCCTTATGCTGGCTTTGTCTTCTCGAGAAGACAAAGCCAGCATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013845
CXorf40B MISSION shRNA Lentiviral Transduction Particles
chromosome X open reading frame 40B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-804s1c1
Sequence:CCGGCGAAGACTTAACTCCCGATGACTCGAGTCATCGGGAGTTAAGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-868s1c1
Sequence:CCGGCAGAAGTACCTGACTGTGATTCTCGAGAATCACAGTCAGGTACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-820s1c1
Sequence:CCGGGATGAGGTTGTGGAACTAGAACTCGAGTTCTAGTTCCACAACCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-873s1c1
Sequence:CCGGGTACCTGACTGTGATTTCAAACTCGAGTTTGAAATCACAGTCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-557s1c1
Sequence:CCGGGCTTTGTCTTAAATGGAATCACTCGAGTGATTCCATTTAAGACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-924s1c1
Sequence:CCGGGAAAGGAGGCAAGGATGTATTCTCGAGAATACATCCTTGCCTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164346    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-933s1c1
Sequence:CCGGCAAGGATGTATTCCAGGTAGACTCGAGTCTACCTGGAATACATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-855s1c1
Sequence:CCGGGACCAACCTGAAGCAGAAGTACTCGAGTACTTCTGCTTCAGGTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013845.1-546s1c1
Sequence:CCGGGCCTTATGCTGGCTTTGTCTTCTCGAGAAGACAAAGCCAGCATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks