EMAIL THIS PAGE TO A FRIEND

CXorf48

chromosome X open reading frame 48

34 Gene Product Result for
Synonyms: BJHCC20A CT55
Species: Human CXorf48(54967)
UniProtKB ID: Q8WUE5, Q9NWY8
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017863 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017863 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017863 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127681 MISSION® esiRNA esiRNA human CXorf48 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031705 Rosetta Predictions human pricing
NM_017863 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112846 predicted 508
2 SASI_Hs02_00307720 predicted 412
3 SASI_Hs01_00112849 predicted 506
4 SASI_Hs02_00307721 predicted 508
5 SASI_Hs01_00112851 predicted 523
6 SASI_Hs01_00112853 predicted 553
7 SASI_Hs02_00307722 predicted 314
8 SASI_Hs02_00307723 predicted 560
9 SASI_Hs02_00307724 predicted 488
10 SASI_Hs02_00307725 predicted 426
11 SASI_Hs01_00112844 predicted 235
12 SASI_Hs01_00112845 predicted 380
13 SASI_Hs01_00112847 predicted 383
14 SASI_Hs01_00112848 predicted 225
15 SASI_Hs01_00112850 predicted 350
16 SASI_Hs01_00112852 predicted 213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017863 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242224 predicted 818
2 SASI_Hs01_00242227 predicted 975
3 SASI_Hs01_00242228 predicted 814
4 SASI_Hs01_00242229 predicted 1095
5 SASI_Hs01_00242230 predicted 934
6 SASI_Hs02_00350778 predicted 1097
7 SASI_Hs01_00242231 predicted 1123
8 SASI_Hs01_00242232 predicted 805
9 SASI_Hs01_00242233 predicted 1143
10 SASI_Hs02_00350779 predicted 933
11 SASI_Hs01_00242225 predicted 969
12 SASI_Hs01_00242226 predicted 1108
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017863
CXorf48 MISSION shRNA Bacterial Glycerol Stock
chromosome X open reading frame 48
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017863.2-773s1c1
Sequence:CCGGGCAGGGAGTTGTCACAAGTTTCTCGAGAAACTTGTGACAACTCCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017863.2-1914s1c1
Sequence:CCGGGCTAGAATGTAAACTCCACAACTCGAGTTGTGGAGTTTACATTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017863.2-1283s1c1
Sequence:CCGGCGTACCTCAAGTAGATGATATCTCGAGATATCATCTACTTGAGGTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017863.2-1088s1c1
Sequence:CCGGGCCTTATAAGGGTGACTTGTTCTCGAGAACAAGTCACCCTTATAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017863.2-1172s1c1
Sequence:CCGGCCGTTGTATTCATACGGAAGACTCGAGTCTTCCGTATGAATACAACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017863.2-1161s1c1
Sequence:CCGGGTGAAGCCCATCCGTTGTATTCTCGAGAATACAACGGATGGGCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017863.2-1456s21c1
Sequence:CCGGTTAGCTTAGTAAGCCTAAATACTCGAGTATTTAGGCTTACTAAGCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017863.2-1057s21c1
Sequence:CCGGTTTCCATAGCCATTGTTTCTGCTCGAGCAGAAACAATGGCTATGGAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017863.2-1748s21c1
Sequence:CCGGCATCAGGGACAGCATGTTAAACTCGAGTTTAACATGCTGTCCCTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017863
CXorf48 MISSION shRNA shRNA Plasmid DNA
chromosome X open reading frame 48
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017863.2-773s1c1
Sequence:CCGGGCAGGGAGTTGTCACAAGTTTCTCGAGAAACTTGTGACAACTCCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017863.2-1914s1c1
Sequence:CCGGGCTAGAATGTAAACTCCACAACTCGAGTTGTGGAGTTTACATTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017863.2-1283s1c1
Sequence:CCGGCGTACCTCAAGTAGATGATATCTCGAGATATCATCTACTTGAGGTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017863.2-1088s1c1
Sequence:CCGGGCCTTATAAGGGTGACTTGTTCTCGAGAACAAGTCACCCTTATAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017863.2-1172s1c1
Sequence:CCGGCCGTTGTATTCATACGGAAGACTCGAGTCTTCCGTATGAATACAACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017863.2-1161s1c1
Sequence:CCGGGTGAAGCCCATCCGTTGTATTCTCGAGAATACAACGGATGGGCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017863.2-1456s21c1
Sequence:CCGGTTAGCTTAGTAAGCCTAAATACTCGAGTATTTAGGCTTACTAAGCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017863.2-1057s21c1
Sequence:CCGGTTTCCATAGCCATTGTTTCTGCTCGAGCAGAAACAATGGCTATGGAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017863.2-1748s21c1
Sequence:CCGGCATCAGGGACAGCATGTTAAACTCGAGTTTAACATGCTGTCCCTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017863
CXorf48 MISSION shRNA Lentiviral Transduction Particles
chromosome X open reading frame 48
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017863.2-773s1c1
Sequence:CCGGGCAGGGAGTTGTCACAAGTTTCTCGAGAAACTTGTGACAACTCCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017863.2-1914s1c1
Sequence:CCGGGCTAGAATGTAAACTCCACAACTCGAGTTGTGGAGTTTACATTCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017863.2-1283s1c1
Sequence:CCGGCGTACCTCAAGTAGATGATATCTCGAGATATCATCTACTTGAGGTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017863.2-1088s1c1
Sequence:CCGGGCCTTATAAGGGTGACTTGTTCTCGAGAACAAGTCACCCTTATAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179744    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017863.2-1172s1c1
Sequence:CCGGCCGTTGTATTCATACGGAAGACTCGAGTCTTCCGTATGAATACAACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017863.2-1161s1c1
Sequence:CCGGGTGAAGCCCATCCGTTGTATTCTCGAGAATACAACGGATGGGCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430271    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017863.2-1456s21c1
Sequence:CCGGTTAGCTTAGTAAGCCTAAATACTCGAGTATTTAGGCTTACTAAGCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017863.2-1057s21c1
Sequence:CCGGTTTCCATAGCCATTGTTTCTGCTCGAGCAGAAACAATGGCTATGGAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017863.2-1748s21c1
Sequence:CCGGCATCAGGGACAGCATGTTAAACTCGAGTTTAACATGCTGTCCCTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)