EMAIL THIS PAGE TO A FRIEND

CXorf49

chromosome X open reading frame 49

32 Gene Product Result for
Synonyms: CXorf49B
Species: Human CXorf49(100130361)
UniProtKB ID: A8MYA2
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145140 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145140 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145140 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001715406 Rosetta Predictions human pricing
XM_001715695 Rosetta Predictions human pricing
XM_001716527 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00403469 predicted 536
2 SASI_Hs02_00403470 predicted 894
3 SASI_Hs02_00403471 predicted 1051
4 SASI_Hs02_00403472 predicted 448
5 SASI_Hs02_00403473 predicted 437
6 SASI_Hs02_00403474 predicted 551
7 SASI_Hs02_00403475 predicted 458
8 SASI_Hs02_00403476 predicted 883
9 SASI_Hs02_00403477 predicted 876
10 SASI_Hs02_00403478 predicted 200
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001715695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00405475 predicted 504
2 SASI_Hs02_00405476 predicted 874
3 SASI_Hs02_00405477 predicted 1024
4 SASI_Hs02_00405478 predicted 417
5 SASI_Hs02_00405479 predicted 420
6 SASI_Hs02_00405480 predicted 526
7 SASI_Hs02_00405481 predicted 430
8 SASI_Hs02_00405482 predicted 859
9 SASI_Hs02_00405483 predicted 851
10 SASI_Hs02_00405484 predicted 1485
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716527 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00411219 predicted 1405
2 SASI_Hs02_00411220 predicted 1488
3 SASI_Hs02_00411221 predicted 1027
4 SASI_Hs02_00411222 predicted 1602
5 SASI_Hs02_00411223 predicted 1027
6 SASI_Hs02_00411224 predicted 1158
7 SASI_Hs02_00411225 predicted 1165
8 SASI_Hs02_00411226 predicted 1486
9 SASI_Hs02_00411227 predicted 1399
10 SASI_Hs02_00411228 predicted 1279
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145140
CXorf49 MISSION shRNA Bacterial Glycerol Stock
chromosome X open reading frame 49
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145140.1-410s21c1
Sequence:CCGGGGACGTTGTGGACTACTCATTCTCGAGAATGAGTAGTCCACAACGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145140.1-775s21c1
Sequence:CCGGCACTGATGAAGGTAGGCATTTCTCGAGAAATGCCTACCTTCATCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145140.1-325s21c1
Sequence:CCGGAGTCTGAGAGCGAATTGATAGCTCGAGCTATCAATTCGCTCTCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145140.1-740s21c1
Sequence:CCGGCGACTCTGATTCCGCAGATGACTCGAGTCATCTGCGGAATCAGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145140.1-1315s21c1
Sequence:CCGGGAGAAGATAATGACCCAAATACTCGAGTATTTGGGTCATTATCTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145140
CXorf49 MISSION shRNA shRNA Plasmid DNA
chromosome X open reading frame 49
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145140.1-410s21c1
Sequence:CCGGGGACGTTGTGGACTACTCATTCTCGAGAATGAGTAGTCCACAACGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145140.1-775s21c1
Sequence:CCGGCACTGATGAAGGTAGGCATTTCTCGAGAAATGCCTACCTTCATCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145140.1-325s21c1
Sequence:CCGGAGTCTGAGAGCGAATTGATAGCTCGAGCTATCAATTCGCTCTCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145140.1-740s21c1
Sequence:CCGGCGACTCTGATTCCGCAGATGACTCGAGTCATCTGCGGAATCAGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000337439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145140.1-1315s21c1
Sequence:CCGGGAGAAGATAATGACCCAAATACTCGAGTATTTGGGTCATTATCTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145140
CXorf49 MISSION shRNA Lentiviral Transduction Particles
chromosome X open reading frame 49
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145140.1-410s21c1
Sequence:CCGGGGACGTTGTGGACTACTCATTCTCGAGAATGAGTAGTCCACAACGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145140.1-775s21c1
Sequence:CCGGCACTGATGAAGGTAGGCATTTCTCGAGAAATGCCTACCTTCATCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145140.1-325s21c1
Sequence:CCGGAGTCTGAGAGCGAATTGATAGCTCGAGCTATCAATTCGCTCTCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145140.1-740s21c1
Sequence:CCGGCGACTCTGATTCCGCAGATGACTCGAGTCATCTGCGGAATCAGAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000337439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145140.1-1315s21c1
Sequence:CCGGGAGAAGATAATGACCCAAATACTCGAGTATTTGGGTCATTATCTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)