EMAIL THIS PAGE TO A FRIEND

CXorf49B

chromosome X open reading frame 49B

12 Gene Product Result for
Species: Human CXorf49B(100132994)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145139 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145139 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145139 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001716545 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001716545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00411332 predicted 512
2 SASI_Hs02_00411333 predicted 874
3 SASI_Hs02_00411334 predicted 1025
4 SASI_Hs02_00411335 predicted 426
5 SASI_Hs02_00411336 predicted 412
6 SASI_Hs02_00411337 predicted 413
7 SASI_Hs02_00411338 predicted 525
8 SASI_Hs02_00411339 predicted 873
9 SASI_Hs02_00411340 predicted 434
10 SASI_Hs02_00411341 predicted 863
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145139
CXorf49B MISSION shRNA Bacterial Glycerol Stock
chromosome X open reading frame 49B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000337426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145139.1-776s21c1
Sequence:CCGGACTGATGAAGGTAGGCATTTGCTCGAGCAAATGCCTACCTTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145139.1-411s21c1
Sequence:CCGGGACGTTGTGGACTACTCATTCCTCGAGGAATGAGTAGTCCACAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145139.1-754s21c1
Sequence:CCGGCAGATGAGAGCAGCGACTTACCTCGAGGTAAGTCGCTGCTCTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145139.1-321s21c1
Sequence:CCGGTTCGAGTCTGAGAGCGAATTGCTCGAGCAATTCGCTCTCAGACTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145139.1-1314s21c1
Sequence:CCGGAGAGAAGATAATGACCCAAATCTCGAGATTTGGGTCATTATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145139
CXorf49B MISSION shRNA shRNA Plasmid DNA
chromosome X open reading frame 49B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000337426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145139.1-776s21c1
Sequence:CCGGACTGATGAAGGTAGGCATTTGCTCGAGCAAATGCCTACCTTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145139.1-411s21c1
Sequence:CCGGGACGTTGTGGACTACTCATTCCTCGAGGAATGAGTAGTCCACAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145139.1-754s21c1
Sequence:CCGGCAGATGAGAGCAGCGACTTACCTCGAGGTAAGTCGCTGCTCTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145139.1-321s21c1
Sequence:CCGGTTCGAGTCTGAGAGCGAATTGCTCGAGCAATTCGCTCTCAGACTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145139.1-1314s21c1
Sequence:CCGGAGAGAAGATAATGACCCAAATCTCGAGATTTGGGTCATTATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145139
CXorf49B MISSION shRNA Lentiviral Transduction Particles
chromosome X open reading frame 49B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000337426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145139.1-776s21c1
Sequence:CCGGACTGATGAAGGTAGGCATTTGCTCGAGCAAATGCCTACCTTCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145139.1-411s21c1
Sequence:CCGGGACGTTGTGGACTACTCATTCCTCGAGGAATGAGTAGTCCACAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145139.1-754s21c1
Sequence:CCGGCAGATGAGAGCAGCGACTTACCTCGAGGTAAGTCGCTGCTCTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145139.1-321s21c1
Sequence:CCGGTTCGAGTCTGAGAGCGAATTGCTCGAGCAATTCGCTCTCAGACTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145139.1-1314s21c1
Sequence:CCGGAGAGAAGATAATGACCCAAATCTCGAGATTTGGGTCATTATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks