EMAIL THIS PAGE TO A FRIEND

CXorf56

chromosome X open reading frame 56

34 Gene Product Result for
UniProtKB ID: Q9H5V9, A8MPX7, B4DQN2, D3DWH9, F5GWL7, O43351
Gene ID:
Human(63932) Summary: While this gene is well-supported by transcript data, no functional information on its protein products is currently available. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
chicken(428719) chromosome 4 open reading frame, human CXorf56
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022101 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022101 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022101 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU113251 MISSION® esiRNA esiRNA human CXorf56 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022101 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022101 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198529 predicted 560
2 SASI_Hs01_00198530 predicted 468
3 SASI_Hs02_00355489 predicted 287
4 SASI_Hs01_00198532 predicted 352
5 SASI_Hs01_00198533 predicted 249
6 SASI_Hs01_00198534 predicted 518
7 SASI_Hs01_00198535 predicted 222
8 SASI_Hs01_00198536 predicted 306
9 SASI_Hs01_00198537 predicted 370
10 SASI_Hs02_00355490 predicted 227
11 SASI_Hs01_00198531 predicted 552
12 SASI_Hs01_00198538 predicted 286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022101
CXorf56 MISSION shRNA Bacterial Glycerol Stock
chromosome X open reading frame 56
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022101.3-798s21c1
Sequence:CCGGGGCAAAGTAATTTCTTGATTACTCGAGTAATCAAGAAATTACTTTGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022101.3-857s21c1
Sequence:CCGGTACGTTGTTTCCCATTGATTCCTCGAGGAATCAATGGGAAACAACGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022101.3-819s21c1
Sequence:CCGGCATAGACGGATTCCTATTTATCTCGAGATAAATAGGAATCCGTCTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168623    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022101.2-750s1c1
Sequence:CCGGGCATTTAGATCAGGAGGCAAACTCGAGTTTGCCTCCTGATCTAAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022101.2-520s1c1
Sequence:CCGGCGTGTCTACCATTGATGAAGACTCGAGTCTTCATCAATGGTAGACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022101.2-374s1c1
Sequence:CCGGCCTGTTACCTTCATTGTGGATCTCGAGATCCACAATGAAGGTAACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022101.2-691s1c1
Sequence:CCGGCTTGATTGACAACCAGTTCAACTCGAGTTGAACTGGTTGTCAATCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022101
CXorf56 MISSION shRNA shRNA Plasmid DNA
chromosome X open reading frame 56
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022101.3-798s21c1
Sequence:CCGGGGCAAAGTAATTTCTTGATTACTCGAGTAATCAAGAAATTACTTTGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022101.3-857s21c1
Sequence:CCGGTACGTTGTTTCCCATTGATTCCTCGAGGAATCAATGGGAAACAACGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022101.3-819s21c1
Sequence:CCGGCATAGACGGATTCCTATTTATCTCGAGATAAATAGGAATCCGTCTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168623    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022101.2-750s1c1
Sequence:CCGGGCATTTAGATCAGGAGGCAAACTCGAGTTTGCCTCCTGATCTAAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022101.2-520s1c1
Sequence:CCGGCGTGTCTACCATTGATGAAGACTCGAGTCTTCATCAATGGTAGACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022101.2-374s1c1
Sequence:CCGGCCTGTTACCTTCATTGTGGATCTCGAGATCCACAATGAAGGTAACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022101.2-691s1c1
Sequence:CCGGCTTGATTGACAACCAGTTCAACTCGAGTTGAACTGGTTGTCAATCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022101
CXorf56 MISSION shRNA Lentiviral Transduction Particles
chromosome X open reading frame 56
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022101.3-798s21c1
Sequence:CCGGGGCAAAGTAATTTCTTGATTACTCGAGTAATCAAGAAATTACTTTGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022101.3-857s21c1
Sequence:CCGGTACGTTGTTTCCCATTGATTCCTCGAGGAATCAATGGGAAACAACGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022101.3-819s21c1
Sequence:CCGGCATAGACGGATTCCTATTTATCTCGAGATAAATAGGAATCCGTCTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168623    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_022101.2-750s1c1
Sequence:CCGGGCATTTAGATCAGGAGGCAAACTCGAGTTTGCCTCCTGATCTAAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022101.2-520s1c1
Sequence:CCGGCGTGTCTACCATTGATGAAGACTCGAGTCTTCATCAATGGTAGACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022101.2-374s1c1
Sequence:CCGGCCTGTTACCTTCATTGTGGATCTCGAGATCCACAATGAAGGTAACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022101.2-691s1c1
Sequence:CCGGCTTGATTGACAACCAGTTCAACTCGAGTTGAACTGGTTGTCAATCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)