EMAIL THIS PAGE TO A FRIEND

CXorf57

chromosome X open reading frame 57

93 Gene Product Result for
Species: Human CXorf57(55086)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018015 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018015 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018015 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044571 MISSION® esiRNA esiRNA human CXorf57 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018015 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018015 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176431 predicted 2514
2 SASI_Hs01_00176432 predicted 682
3 SASI_Hs01_00176433 predicted 1856
4 SASI_Hs01_00176434 predicted 2318
5 SASI_Hs01_00176435 predicted 1459
6 SASI_Hs01_00176436 predicted 1667
7 SASI_Hs01_00176437 predicted 641
8 SASI_Hs01_00176438 predicted 1128
9 SASI_Hs01_00176439 predicted 2026
10 SASI_Hs02_00351116 predicted 288
11 SASI_Hs01_00176430 predicted 2167
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018015
CXorf57 MISSION shRNA Bacterial Glycerol Stock
chromosome X open reading frame 57
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130611    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018015.3-2952s1c1
Sequence:CCGGCCTCAGTATAAGGCATCCTAACTCGAGTTAGGATGCCTTATACTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018015.3-2171s1c1
Sequence:CCGGCTGAAAGTATTCCACGGAAATCTCGAGATTTCCGTGGAATACTTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130001    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018015.3-2964s1c1
Sequence:CCGGGCATCCTAACTTACAAGAGTACTCGAGTACTCTTGTAAGTTAGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018015.3-774s1c1
Sequence:CCGGGCTTGTGAGGATCTTACATAACTCGAGTTATGTAAGATCCTCACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018015.3-2242s1c1
Sequence:CCGGGCGAAATATGTACCACCAGAACTCGAGTTCTGGTGGTACATATTTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018015.3-2598s1c1
Sequence:CCGGGCACAAGATTTATAGTCCAGACTCGAGTCTGGACTATAAATCTTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018015.3-1123s1c1
Sequence:CCGGCCAAAGCTAAATCACCGATTTCTCGAGAAATCGGTGATTTAGCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018015.5-2577s21c1
Sequence:CCGGGAGCGGTTGCAGGTGATATTACTCGAGTAATATCACCTGCAACCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018015.5-488s21c1
Sequence:CCGGAGCTTGAACTCTCTCGTATATCTCGAGATATACGAGAGAGTTCAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018015.5-2236s21c1
Sequence:CCGGCCTACACTACAGCCGTGTTTACTCGAGTAAACACGGCTGTAGTGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018015
CXorf57 MISSION shRNA shRNA Plasmid DNA
chromosome X open reading frame 57
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130611    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018015.3-2952s1c1
Sequence:CCGGCCTCAGTATAAGGCATCCTAACTCGAGTTAGGATGCCTTATACTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018015.3-2171s1c1
Sequence:CCGGCTGAAAGTATTCCACGGAAATCTCGAGATTTCCGTGGAATACTTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130001    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018015.3-2964s1c1
Sequence:CCGGGCATCCTAACTTACAAGAGTACTCGAGTACTCTTGTAAGTTAGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018015.3-774s1c1
Sequence:CCGGGCTTGTGAGGATCTTACATAACTCGAGTTATGTAAGATCCTCACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018015.3-2242s1c1
Sequence:CCGGGCGAAATATGTACCACCAGAACTCGAGTTCTGGTGGTACATATTTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018015.3-2598s1c1
Sequence:CCGGGCACAAGATTTATAGTCCAGACTCGAGTCTGGACTATAAATCTTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018015.3-1123s1c1
Sequence:CCGGCCAAAGCTAAATCACCGATTTCTCGAGAAATCGGTGATTTAGCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018015.5-2577s21c1
Sequence:CCGGGAGCGGTTGCAGGTGATATTACTCGAGTAATATCACCTGCAACCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018015.5-488s21c1
Sequence:CCGGAGCTTGAACTCTCTCGTATATCTCGAGATATACGAGAGAGTTCAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018015.5-2236s21c1
Sequence:CCGGCCTACACTACAGCCGTGTTTACTCGAGTAAACACGGCTGTAGTGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018015
CXorf57 MISSION shRNA Lentiviral Transduction Particles
chromosome X open reading frame 57
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130611    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018015.3-2952s1c1
Sequence:CCGGCCTCAGTATAAGGCATCCTAACTCGAGTTAGGATGCCTTATACTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018015.3-2171s1c1
Sequence:CCGGCTGAAAGTATTCCACGGAAATCTCGAGATTTCCGTGGAATACTTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130001    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018015.3-2964s1c1
Sequence:CCGGGCATCCTAACTTACAAGAGTACTCGAGTACTCTTGTAAGTTAGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018015.3-774s1c1
Sequence:CCGGGCTTGTGAGGATCTTACATAACTCGAGTTATGTAAGATCCTCACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149385    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018015.3-2242s1c1
Sequence:CCGGGCGAAATATGTACCACCAGAACTCGAGTTCTGGTGGTACATATTTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018015.3-2598s1c1
Sequence:CCGGGCACAAGATTTATAGTCCAGACTCGAGTCTGGACTATAAATCTTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018015.3-1123s1c1
Sequence:CCGGCCAAAGCTAAATCACCGATTTCTCGAGAAATCGGTGATTTAGCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018015.5-2577s21c1
Sequence:CCGGGAGCGGTTGCAGGTGATATTACTCGAGTAATATCACCTGCAACCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018015.5-488s21c1
Sequence:CCGGAGCTTGAACTCTCTCGTATATCTCGAGATATACGAGAGAGTTCAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018015.5-2236s21c1
Sequence:CCGGCCTACACTACAGCCGTGTTTACTCGAGTAAACACGGCTGTAGTGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)