EMAIL THIS PAGE TO A FRIEND

CXorf58

chromosome X open reading frame 58

31 Gene Product Result for
Species: Human CXorf58(254158)
UniProtKB ID: Q96LI9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152761 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152761 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152761 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053281 MISSION® esiRNA esiRNA human CXorf58 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152761 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139739 predicted 792
2 SASI_Hs01_00139740 predicted 411
3 SASI_Hs01_00139741 predicted 543
4 SASI_Hs01_00139742 predicted 940
5 SASI_Hs01_00139743 predicted 616
6 SASI_Hs01_00139744 predicted 790
7 SASI_Hs01_00139745 predicted 767
8 SASI_Hs01_00139746 predicted 658
9 SASI_Hs01_00139747 predicted 490
10 SASI_Hs01_00139748 predicted 433
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152761
CXorf58 MISSION shRNA Bacterial Glycerol Stock
chromosome X open reading frame 58
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-870s1c1
Sequence:CCGGGATGTTGTCACCATGCAAGATCTCGAGATCTTGCATGGTGACAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152761.1-981s1c1
Sequence:CCGGCCCAGGACAATGCTAATGTATCTCGAGATACATTAGCATTGTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-768s1c1
Sequence:CCGGGCAGTGGATGATGCTTGCAAACTCGAGTTTGCAAGCATCATCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-1201s1c1
Sequence:CCGGGTCGATCCAAGCAAGCTCAAACTCGAGTTTGAGCTTGCTTGGATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-1095s1c1
Sequence:CCGGCATAAGCACCAGCTACGGATTCTCGAGAATCCGTAGCTGGTGCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-1073s1c1
Sequence:CCGGGAGACCAGTAACGCAAGAGATCTCGAGATCTCTTGCGTTACTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152761.1-844s1c1
Sequence:CCGGCGAAGTCCAAAGTAACTGATACTCGAGTATCAGTTACTTTGGACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-430s1c1
Sequence:CCGGCAAATGCACGAAATGCAAGATCTCGAGATCTTGCATTTCGTGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-876s1c1
Sequence:CCGGGTCACCATGCAAGATTATGTACTCGAGTACATAATCTTGCATGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-388s1c1
Sequence:CCGGCAGGTACAAGATCCTTACAAACTCGAGTTTGTAAGGATCTTGTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152761.1-675s1c1
Sequence:CCGGCCACCTTTCATCGTGTTTAAACTCGAGTTTAAACACGATGAAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152761.1-624s1c1
Sequence:CCGGGATCCTACTATGCAGTGTAAACTCGAGTTTACACTGCATAGTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152761.1-435s1c1
Sequence:CCGGGCACGAAATGCAAGATCATTACTCGAGTAATGATCTTGCATTTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-423s1c1
Sequence:CCGGCATTTCGCAAATGCACGAAATCTCGAGATTTCGTGCATTTGCGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152761
CXorf58 MISSION shRNA shRNA Plasmid DNA
chromosome X open reading frame 58
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-870s1c1
Sequence:CCGGGATGTTGTCACCATGCAAGATCTCGAGATCTTGCATGGTGACAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152761.1-981s1c1
Sequence:CCGGCCCAGGACAATGCTAATGTATCTCGAGATACATTAGCATTGTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-768s1c1
Sequence:CCGGGCAGTGGATGATGCTTGCAAACTCGAGTTTGCAAGCATCATCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-1201s1c1
Sequence:CCGGGTCGATCCAAGCAAGCTCAAACTCGAGTTTGAGCTTGCTTGGATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-1095s1c1
Sequence:CCGGCATAAGCACCAGCTACGGATTCTCGAGAATCCGTAGCTGGTGCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-1073s1c1
Sequence:CCGGGAGACCAGTAACGCAAGAGATCTCGAGATCTCTTGCGTTACTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152761.1-844s1c1
Sequence:CCGGCGAAGTCCAAAGTAACTGATACTCGAGTATCAGTTACTTTGGACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-430s1c1
Sequence:CCGGCAAATGCACGAAATGCAAGATCTCGAGATCTTGCATTTCGTGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-876s1c1
Sequence:CCGGGTCACCATGCAAGATTATGTACTCGAGTACATAATCTTGCATGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-388s1c1
Sequence:CCGGCAGGTACAAGATCCTTACAAACTCGAGTTTGTAAGGATCTTGTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152761.1-675s1c1
Sequence:CCGGCCACCTTTCATCGTGTTTAAACTCGAGTTTAAACACGATGAAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152761.1-624s1c1
Sequence:CCGGGATCCTACTATGCAGTGTAAACTCGAGTTTACACTGCATAGTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152761.1-435s1c1
Sequence:CCGGGCACGAAATGCAAGATCATTACTCGAGTAATGATCTTGCATTTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-423s1c1
Sequence:CCGGCATTTCGCAAATGCACGAAATCTCGAGATTTCGTGCATTTGCGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152761
CXorf58 MISSION shRNA Lentiviral Transduction Particles
chromosome X open reading frame 58
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-870s1c1
Sequence:CCGGGATGTTGTCACCATGCAAGATCTCGAGATCTTGCATGGTGACAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152761.1-981s1c1
Sequence:CCGGCCCAGGACAATGCTAATGTATCTCGAGATACATTAGCATTGTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142375    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-768s1c1
Sequence:CCGGGCAGTGGATGATGCTTGCAAACTCGAGTTTGCAAGCATCATCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142231    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-1201s1c1
Sequence:CCGGGTCGATCCAAGCAAGCTCAAACTCGAGTTTGAGCTTGCTTGGATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-1095s1c1
Sequence:CCGGCATAAGCACCAGCTACGGATTCTCGAGAATCCGTAGCTGGTGCTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142247    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-1073s1c1
Sequence:CCGGGAGACCAGTAACGCAAGAGATCTCGAGATCTCTTGCGTTACTGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121742    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152761.1-844s1c1
Sequence:CCGGCGAAGTCCAAAGTAACTGATACTCGAGTATCAGTTACTTTGGACTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145614    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-430s1c1
Sequence:CCGGCAAATGCACGAAATGCAAGATCTCGAGATCTTGCATTTCGTGCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145015    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-876s1c1
Sequence:CCGGGTCACCATGCAAGATTATGTACTCGAGTACATAATCTTGCATGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-388s1c1
Sequence:CCGGCAGGTACAAGATCCTTACAAACTCGAGTTTGTAAGGATCTTGTACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152761.1-675s1c1
Sequence:CCGGCCACCTTTCATCGTGTTTAAACTCGAGTTTAAACACGATGAAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152761.1-624s1c1
Sequence:CCGGGATCCTACTATGCAGTGTAAACTCGAGTTTACACTGCATAGTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152761.1-435s1c1
Sequence:CCGGGCACGAAATGCAAGATCATTACTCGAGTAATGATCTTGCATTTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152761.1-423s1c1
Sequence:CCGGCATTTCGCAAATGCACGAAATCTCGAGATTTCGTGCATTTGCGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks