EMAIL THIS PAGE TO A FRIEND

CXorf64

chromosome X open reading frame 64

17 Gene Product Result for
Species: Human CXorf64(100130613)
UniProtKB ID: B1ATL7
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001122716 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001122716 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001122716 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040441 MISSION® esiRNA esiRNA human CXorf64 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001122716 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00327235 predicted 237
2 SASI_Hs02_00327236 predicted 628
3 SASI_Hs02_00327237 predicted 847
4 SASI_Hs02_00327238 predicted 524
5 SASI_Hs02_00327239 predicted 694
6 SASI_Hs02_00327240 predicted 279
7 SASI_Hs02_00327241 predicted 384
8 SASI_Hs02_00327242 predicted 551
9 SASI_Hs02_00327243 predicted 307
10 SASI_Hs02_00327244 predicted 235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001122716
CXorf64 MISSION shRNA Bacterial Glycerol Stock
chromosome X open reading frame 64
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122716.1-439s21c1
Sequence:CCGGAGGAGGGACAGGATGCTATTACTCGAGTAATAGCATCCTGTCCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122716.1-873s21c1
Sequence:CCGGTTTGCTCCTCCTCCGATATTTCTCGAGAAATATCGGAGGAGGAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122716.1-1013s21c1
Sequence:CCGGAGAGGTGAAAGTTATTCATTTCTCGAGAAATGAATAACTTTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122716.1-638s21c1
Sequence:CCGGCCTTAGATCAGGGATAGTAATCTCGAGATTACTATCCCTGATCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122716.1-116s21c1
Sequence:CCGGCCCTTCACCCTTGGTAGTATCCTCGAGGATACTACCAAGGGTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001122716
CXorf64 MISSION shRNA shRNA Plasmid DNA
chromosome X open reading frame 64
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122716.1-439s21c1
Sequence:CCGGAGGAGGGACAGGATGCTATTACTCGAGTAATAGCATCCTGTCCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122716.1-873s21c1
Sequence:CCGGTTTGCTCCTCCTCCGATATTTCTCGAGAAATATCGGAGGAGGAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122716.1-1013s21c1
Sequence:CCGGAGAGGTGAAAGTTATTCATTTCTCGAGAAATGAATAACTTTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122716.1-638s21c1
Sequence:CCGGCCTTAGATCAGGGATAGTAATCTCGAGATTACTATCCCTGATCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122716.1-116s21c1
Sequence:CCGGCCCTTCACCCTTGGTAGTATCCTCGAGGATACTACCAAGGGTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001122716
CXorf64 MISSION shRNA Lentiviral Transduction Particles
chromosome X open reading frame 64
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122716.1-439s21c1
Sequence:CCGGAGGAGGGACAGGATGCTATTACTCGAGTAATAGCATCCTGTCCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122716.1-873s21c1
Sequence:CCGGTTTGCTCCTCCTCCGATATTTCTCGAGAAATATCGGAGGAGGAGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001122716.1-1013s21c1
Sequence:CCGGAGAGGTGAAAGTTATTCATTTCTCGAGAAATGAATAACTTTCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122716.1-638s21c1
Sequence:CCGGCCTTAGATCAGGGATAGTAATCTCGAGATTACTATCCCTGATCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001122716.1-116s21c1
Sequence:CCGGCCCTTCACCCTTGGTAGTATCCTCGAGGATACTACCAAGGGTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks