EMAIL THIS PAGE TO A FRIEND

CXorf65

chromosome X open reading frame 65

17 Gene Product Result for
Species: Human CXorf65(158830)
UniProtKB ID: A6NEN9
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001025265 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025265 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025265 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103821 MISSION® esiRNA esiRNA human RP5-1091N2.8 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025265 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133164 predicted 266
2 SASI_Hs01_00133165 predicted 335
3 SASI_Hs01_00133166 predicted 319
4 SASI_Hs01_00133167 predicted 229
5 SASI_Hs01_00133168 predicted 225
6 SASI_Hs01_00133169 predicted 223
7 SASI_Hs01_00133170 predicted 313
8 SASI_Hs01_00133171 predicted 213
9 SASI_Hs01_00133172 predicted 321
10 SASI_Hs01_00133173 predicted 314
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025265
CXorf65 MISSION shRNA Bacterial Glycerol Stock
chromosome X open reading frame 65
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025265.2-399s21c1
Sequence:CCGGAGCCCAATCATGCAGAGTATGCTCGAGCATACTCTGCATGATTGGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025265.2-741s21c1
Sequence:CCGGATAAAGGTCGCCAACTCAATACTCGAGTATTGAGTTGGCGACCTTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025265.2-546s21c1
Sequence:CCGGTGCTTGTTGCACTGCGCATACCTCGAGGTATGCGCAGTGCAACAAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025265.1-201s1c1
Sequence:CCGGGCCAGCAAATACCTTACAGCTCTCGAGAGCTGTAAGGTATTTGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025265.1-86s1c1
Sequence:CCGGGCTGTATTACATCCGCAGTAACTCGAGTTACTGCGGATGTAATACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025265.1-396s1c1
Sequence:CCGGGAAGCCAAGAAGGTCGTTATACTCGAGTATAACGACCTTCTTGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025265.1-77s1c1
Sequence:CCGGCGTCGTGTTGCTGTATTACATCTCGAGATGTAATACAGCAACACGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025265.1-184s1c1
Sequence:CCGGCCAATCATGCAGAGTATGCCACTCGAGTGGCATACTCTGCATGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025265.1-205s1c1
Sequence:CCGGGCAAATACCTTACAGCTCGAACTCGAGTTCGAGCTGTAAGGTATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025265.1-95s1c1
Sequence:CCGGCATCCGCAGTAAAGTAAAGTTCTCGAGAACTTTACTTTACTGCGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025265
CXorf65 MISSION shRNA shRNA Plasmid DNA
chromosome X open reading frame 65
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025265.2-399s21c1
Sequence:CCGGAGCCCAATCATGCAGAGTATGCTCGAGCATACTCTGCATGATTGGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025265.2-741s21c1
Sequence:CCGGATAAAGGTCGCCAACTCAATACTCGAGTATTGAGTTGGCGACCTTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025265.2-546s21c1
Sequence:CCGGTGCTTGTTGCACTGCGCATACCTCGAGGTATGCGCAGTGCAACAAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025265.1-201s1c1
Sequence:CCGGGCCAGCAAATACCTTACAGCTCTCGAGAGCTGTAAGGTATTTGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025265.1-86s1c1
Sequence:CCGGGCTGTATTACATCCGCAGTAACTCGAGTTACTGCGGATGTAATACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025265.1-396s1c1
Sequence:CCGGGAAGCCAAGAAGGTCGTTATACTCGAGTATAACGACCTTCTTGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025265.1-77s1c1
Sequence:CCGGCGTCGTGTTGCTGTATTACATCTCGAGATGTAATACAGCAACACGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025265.1-184s1c1
Sequence:CCGGCCAATCATGCAGAGTATGCCACTCGAGTGGCATACTCTGCATGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025265.1-205s1c1
Sequence:CCGGGCAAATACCTTACAGCTCGAACTCGAGTTCGAGCTGTAAGGTATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025265.1-95s1c1
Sequence:CCGGCATCCGCAGTAAAGTAAAGTTCTCGAGAACTTTACTTTACTGCGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025265
CXorf65 MISSION shRNA Lentiviral Transduction Particles
chromosome X open reading frame 65
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025265.2-399s21c1
Sequence:CCGGAGCCCAATCATGCAGAGTATGCTCGAGCATACTCTGCATGATTGGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025265.2-741s21c1
Sequence:CCGGATAAAGGTCGCCAACTCAATACTCGAGTATTGAGTTGGCGACCTTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025265.2-546s21c1
Sequence:CCGGTGCTTGTTGCACTGCGCATACCTCGAGGTATGCGCAGTGCAACAAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025265.1-201s1c1
Sequence:CCGGGCCAGCAAATACCTTACAGCTCTCGAGAGCTGTAAGGTATTTGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025265.1-86s1c1
Sequence:CCGGGCTGTATTACATCCGCAGTAACTCGAGTTACTGCGGATGTAATACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025265.1-396s1c1
Sequence:CCGGGAAGCCAAGAAGGTCGTTATACTCGAGTATAACGACCTTCTTGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025265.1-77s1c1
Sequence:CCGGCGTCGTGTTGCTGTATTACATCTCGAGATGTAATACAGCAACACGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001025265.1-184s1c1
Sequence:CCGGCCAATCATGCAGAGTATGCCACTCGAGTGGCATACTCTGCATGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025265.1-205s1c1
Sequence:CCGGGCAAATACCTTACAGCTCGAACTCGAGTTCGAGCTGTAAGGTATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025265.1-95s1c1
Sequence:CCGGCATCCGCAGTAAAGTAAAGTTCTCGAGAACTTTACTTTACTGCGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)