EMAIL THIS PAGE TO A FRIEND

CXorf66

chromosome X open reading frame 66

22 Gene Product Result for
Species: Human CXorf66(347487)
UniProtKB ID: Q5JRM2
Gene ID:
Human(347487) Summary: The protein encoded by this gene is predicted to be a type I membrane protein, however, its exact function is not known. [provided by RefSeq, Sep 2009]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013403 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013403 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013403 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142011 MISSION® esiRNA esiRNA human CXorf66 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013403 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027246 predicted 966
2 SASI_Hs02_00306356 predicted 381
3 SASI_Hs01_00027248 predicted 809
4 SASI_Hs01_00027249 predicted 651
5 SASI_Hs01_00027251 predicted 849
6 SASI_Hs02_00306357 predicted 794
7 SASI_Hs01_00027252 predicted 327
8 SASI_Hs01_00027253 predicted 344
9 SASI_Hs01_00027254 predicted 280
10 SASI_Hs01_00027255 predicted 463
11 SASI_Hs01_00027247 predicted 1011
12 SASI_Hs01_00027250 predicted 1034
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013403
CXorf66 MISSION shRNA Bacterial Glycerol Stock
chromosome X open reading frame 66
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013403.1-343s1c1
Sequence:CCGGCCAGAAACACAACCCATGCTACTCGAGTAGCATGGGTTGTGTTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013403.1-1131s1c1
Sequence:CCGGCCAAGTGTGAAAGAGCAAACTCTCGAGAGTTTGCTCTTTCACACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013403.1-482s1c1
Sequence:CCGGGAAAGTTAACTAGGCCATCATCTCGAGATGATGGCCTAGTTAACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013403.1-479s1c1
Sequence:CCGGCAGGAAAGTTAACTAGGCCATCTCGAGATGGCCTAGTTAACTTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013403.1-996s1c1
Sequence:CCGGGAATGACAGTGATACGATGAACTCGAGTTCATCGTATCACTGTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013403
CXorf66 MISSION shRNA shRNA Plasmid DNA
chromosome X open reading frame 66
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013403.1-343s1c1
Sequence:CCGGCCAGAAACACAACCCATGCTACTCGAGTAGCATGGGTTGTGTTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013403.1-1131s1c1
Sequence:CCGGCCAAGTGTGAAAGAGCAAACTCTCGAGAGTTTGCTCTTTCACACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013403.1-482s1c1
Sequence:CCGGGAAAGTTAACTAGGCCATCATCTCGAGATGATGGCCTAGTTAACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000129240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013403.1-479s1c1
Sequence:CCGGCAGGAAAGTTAACTAGGCCATCTCGAGATGGCCTAGTTAACTTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013403.1-996s1c1
Sequence:CCGGGAATGACAGTGATACGATGAACTCGAGTTCATCGTATCACTGTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013403
CXorf66 MISSION shRNA Lentiviral Transduction Particles
chromosome X open reading frame 66
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013403.1-343s1c1
Sequence:CCGGCCAGAAACACAACCCATGCTACTCGAGTAGCATGGGTTGTGTTTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001013403.1-1131s1c1
Sequence:CCGGCCAAGTGTGAAAGAGCAAACTCTCGAGAGTTTGCTCTTTCACACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013403.1-482s1c1
Sequence:CCGGGAAAGTTAACTAGGCCATCATCTCGAGATGATGGCCTAGTTAACTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000129240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013403.1-479s1c1
Sequence:CCGGCAGGAAAGTTAACTAGGCCATCTCGAGATGGCCTAGTTAACTTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013403.1-996s1c1
Sequence:CCGGGAATGACAGTGATACGATGAACTCGAGTTCATCGTATCACTGTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)