EMAIL THIS PAGE TO A FRIEND

CXorf67

chromosome X open reading frame 67

16 Gene Product Result for
Species: Human CXorf67(340602)
UniProtKB ID: Q86X51
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107156 Anti-CXORF67 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
SAB2103876 Anti-LOC340602 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_203407 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_203407 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_203407 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_203407 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203407 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110662 predicted 741
2 SASI_Hs01_00110663 predicted 731
3 SASI_Hs01_00110664 predicted 388
4 SASI_Hs01_00110665 predicted 1157
5 SASI_Hs01_00110666 predicted 1639
6 SASI_Hs01_00110667 predicted 1175
7 SASI_Hs01_00110668 predicted 1652
8 SASI_Hs01_00110669 predicted 1481
9 SASI_Hs02_00373337 predicted 1304
10 SASI_Hs02_00373338 predicted 1634
11 SASI_Hs01_00110661 predicted 1619
12 SASI_Hs01_00110670 predicted 1348
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_203407
CXorf67 MISSION shRNA Bacterial Glycerol Stock
chromosome X open reading frame 67
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203407.1-1555s1c1
Sequence:CCGGCCAGAAGAGCAGGCAGAAATACTCGAGTATTTCTGCCTGCTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166339    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203407.1-1776s1c1
Sequence:CCGGCCTAGCACTTAACCTGCTGTTCTCGAGAACAGCAGGTTAAGTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203407.1-1229s1c1
Sequence:CCGGCAGAAAGGCTTGCCTTTCAGACTCGAGTCTGAAAGGCAAGCCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203407.1-1564s1c1
Sequence:CCGGCAGGCAGAAATAGAGAGCACACTCGAGTGTGCTCTCTATTTCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203407.1-1499s1c1
Sequence:CCGGCTGAAAGCCTTAGGTATGCTTCTCGAGAAGCATACCTAAGGCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203407.1-1567s1c1
Sequence:CCGGGCAGAAATAGAGAGCACAGCTCTCGAGAGCTGTGCTCTCTATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203407.1-362s1c1
Sequence:CCGGCAATCATAGCTGCTGTGCTGACTCGAGTCAGCACAGCAGCTATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203407.1-1198s1c1
Sequence:CCGGGCTGATGAGAATCCTTCCTGTCTCGAGACAGGAAGGATTCTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_203407
CXorf67 MISSION shRNA shRNA Plasmid DNA
chromosome X open reading frame 67
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203407.1-1555s1c1
Sequence:CCGGCCAGAAGAGCAGGCAGAAATACTCGAGTATTTCTGCCTGCTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166339    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203407.1-1776s1c1
Sequence:CCGGCCTAGCACTTAACCTGCTGTTCTCGAGAACAGCAGGTTAAGTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203407.1-1229s1c1
Sequence:CCGGCAGAAAGGCTTGCCTTTCAGACTCGAGTCTGAAAGGCAAGCCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203407.1-1564s1c1
Sequence:CCGGCAGGCAGAAATAGAGAGCACACTCGAGTGTGCTCTCTATTTCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203407.1-1499s1c1
Sequence:CCGGCTGAAAGCCTTAGGTATGCTTCTCGAGAAGCATACCTAAGGCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203407.1-1567s1c1
Sequence:CCGGGCAGAAATAGAGAGCACAGCTCTCGAGAGCTGTGCTCTCTATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203407.1-362s1c1
Sequence:CCGGCAATCATAGCTGCTGTGCTGACTCGAGTCAGCACAGCAGCTATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203407.1-1198s1c1
Sequence:CCGGGCTGATGAGAATCCTTCCTGTCTCGAGACAGGAAGGATTCTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_203407
CXorf67 MISSION shRNA Lentiviral Transduction Particles
chromosome X open reading frame 67
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203407.1-1555s1c1
Sequence:CCGGCCAGAAGAGCAGGCAGAAATACTCGAGTATTTCTGCCTGCTCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166339    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_203407.1-1776s1c1
Sequence:CCGGCCTAGCACTTAACCTGCTGTTCTCGAGAACAGCAGGTTAAGTGCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166338    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203407.1-1229s1c1
Sequence:CCGGCAGAAAGGCTTGCCTTTCAGACTCGAGTCTGAAAGGCAAGCCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203407.1-1564s1c1
Sequence:CCGGCAGGCAGAAATAGAGAGCACACTCGAGTGTGCTCTCTATTTCTGCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203407.1-1499s1c1
Sequence:CCGGCTGAAAGCCTTAGGTATGCTTCTCGAGAAGCATACCTAAGGCTTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203407.1-1567s1c1
Sequence:CCGGGCAGAAATAGAGAGCACAGCTCTCGAGAGCTGTGCTCTCTATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164726    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203407.1-362s1c1
Sequence:CCGGCAATCATAGCTGCTGTGCTGACTCGAGTCAGCACAGCAGCTATGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165562    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_203407.1-1198s1c1
Sequence:CCGGGCTGATGAGAATCCTTCCTGTCTCGAGACAGGAAGGATTCTCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks