EMAIL THIS PAGE TO A FRIEND

CYB561

cytochrome b561

81 Gene Product Result for
Synonyms: CYB561A1 FRRS2
UniProtKB ID: P49447, B2RE96, D3DU11, Q5BJG9, Q9BU05, Q9BWR9
Gene ID:
Mouse(13056) cytochrome b-561
Rat(303601) cytochrome b-561
sheep(100048995) cytochrome b-561
Zebrafish(568765) cytochrome b-561
dog(610631) cytochrome b-561
cow(317663) cytochrome b-561
chicken(419952) cytochrome b-561
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100515 Anti-CYB561 (ab1) antibody produced in rabbit affinity isolated antibody , human, guinea pig, bovine, pig, rabbit, sheep, mouse, canine, rat, horse
western blot pricing
SAB2100516 Anti-CYB561 (ab2) antibody produced in rabbit affinity isolated antibody canine, pig, guinea pig, bovine, rat, horse, sheep, human, mouse, rabbit
western blot pricing
SAB2100517 Anti-CYB561 (ab3) antibody produced in rabbit affinity isolated antibody pig, guinea pig, bovine, mouse, rabbit, horse, sheep, rat, canine, human
western blot pricing
HPA014753 Anti-CYB561 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001915 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001915 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001915 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007805 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007805 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007805 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017916 Rosetta Predictions human pricing
NM_001017917 Rosetta Predictions human pricing
NM_001017918 Rosetta Predictions human pricing
NM_001915 Rosetta Predictions human pricing
NM_001107056 Rosetta Predictions rat pricing
NM_007805 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017916 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110098 predicted 1516
2 SASI_Hs01_00110099 predicted 496
3 SASI_Hs01_00110101 predicted 1481
4 SASI_Hs01_00110102 predicted 856
5 SASI_Hs01_00110104 predicted 505
6 SASI_Hs01_00110105 predicted 1259
7 SASI_Hs01_00110106 predicted 1338
8 SASI_Hs02_00306799 predicted 1000
9 SASI_Hs01_00110107 predicted 628
10 SASI_Hs02_00306800 predicted 741
11 SASI_Hs01_00110100 predicted 713
12 SASI_Hs01_00110103 predicted 1336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094438 predicted 1346
2 SASI_Hs01_00094439 predicted 327
3 SASI_Hs01_00094441 predicted 1320
4 SASI_Hs01_00094442 predicted 696
5 SASI_Hs01_00094444 predicted 335
6 SASI_Hs01_00094445 predicted 1089
7 SASI_Hs01_00094446 predicted 1178
8 SASI_Hs02_00306801 predicted 827
9 SASI_Hs01_00094447 predicted 460
10 SASI_Hs02_00306802 predicted 573
11 SASI_Hs01_00094440 predicted 553
12 SASI_Hs01_00094443 predicted 1171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024797 predicted 1377
2 SASI_Hs01_00024798 predicted 354
3 SASI_Hs01_00024799 predicted 572
4 SASI_Hs01_00024800 predicted 1347
5 SASI_Hs01_00024801 predicted 723
6 SASI_Hs01_00024802 predicted 1205
7 SASI_Hs01_00024803 predicted 366
8 SASI_Hs01_00024804 predicted 1124
9 SASI_Hs01_00024805 predicted 1206
10 SASI_Hs01_00024806 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001915 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181341 predicted 1346
2 SASI_Hs01_00181342 predicted 322
3 SASI_Hs01_00181344 predicted 1317
4 SASI_Hs01_00181345 predicted 693
5 SASI_Hs01_00181347 predicted 332
6 SASI_Hs01_00181348 predicted 1086
7 SASI_Hs01_00181349 predicted 1172
8 SASI_Hs02_00332796 predicted 829
9 SASI_Hs01_00181350 predicted 455
10 SASI_Hs02_00332797 predicted 563
11 SASI_Hs01_00181343 predicted 542
12 SASI_Hs01_00181346 predicted 1166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225056 predicted 613
2 SASI_Rn02_00225057 predicted 981
3 SASI_Rn02_00225058 predicted 542
4 SASI_Rn02_00225059 predicted 1439
5 SASI_Rn02_00225060 predicted 713
6 SASI_Rn02_00225061 predicted 570
7 SASI_Rn02_00225062 predicted 483
8 SASI_Rn02_00225063 predicted 1449
9 SASI_Rn02_00225064 predicted 1447
10 SASI_Rn02_00225065 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007805 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069482 predicted 413
2 SASI_Mm01_00069483 predicted 1084
3 SASI_Mm01_00069484 predicted 251
4 SASI_Mm01_00069485 predicted 603
5 SASI_Mm01_00069486 predicted 676
6 SASI_Mm01_00069487 predicted 1007
7 SASI_Mm01_00069488 predicted 203
8 SASI_Mm01_00069489 predicted 1024
9 SASI_Mm01_00069490 predicted 1232
10 SASI_Mm02_00312509 predicted 312
11 SASI_Mm01_00069491 predicted 404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001915
CYB561 MISSION shRNA Bacterial Glycerol Stock
cytochrome b561
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001915.2-291s1c1
Sequence:CCGGCCTGCTGGTTTACCGTGTCTTCTCGAGAAGACACGGTAAACCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001915.2-462s1c1
Sequence:CCGGGATCCTTGTCTTTGTCCTGTACTCGAGTACAGGACAAAGACAAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001915.2-123s1c1
Sequence:CCGGACTGCCTTACTACGTGGCCTTCTCGAGAAGGCCACGTAGTAAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001915.2-357s1c1
Sequence:CCGGGCACATCTTTGCGCTCGTCATCTCGAGATGACGAGCGCAAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001915.2-556s1c1
Sequence:CCGGCGCCCACAGCACATCTTCTTTCTCGAGAAAGAAGATGTGCTGTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001915.3-1308s21c1
Sequence:CCGGGAGTCCCTCCAGCCTGAATAACTCGAGTTATTCAGGCTGGAGGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001915.3-694s21c1
Sequence:CCGGGGGCAAGTATAGCGCATTTGACTCGAGTCAAATGCGCTATACTTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001915
CYB561 MISSION shRNA shRNA Plasmid DNA
cytochrome b561
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001915.2-291s1c1
Sequence:CCGGCCTGCTGGTTTACCGTGTCTTCTCGAGAAGACACGGTAAACCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001915.2-462s1c1
Sequence:CCGGGATCCTTGTCTTTGTCCTGTACTCGAGTACAGGACAAAGACAAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001915.2-123s1c1
Sequence:CCGGACTGCCTTACTACGTGGCCTTCTCGAGAAGGCCACGTAGTAAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001915.2-357s1c1
Sequence:CCGGGCACATCTTTGCGCTCGTCATCTCGAGATGACGAGCGCAAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001915.2-556s1c1
Sequence:CCGGCGCCCACAGCACATCTTCTTTCTCGAGAAAGAAGATGTGCTGTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001915.3-1308s21c1
Sequence:CCGGGAGTCCCTCCAGCCTGAATAACTCGAGTTATTCAGGCTGGAGGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001915.3-694s21c1
Sequence:CCGGGGGCAAGTATAGCGCATTTGACTCGAGTCAAATGCGCTATACTTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001915
CYB561 MISSION shRNA Lentiviral Transduction Particles
cytochrome b561
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001915.2-291s1c1
Sequence:CCGGCCTGCTGGTTTACCGTGTCTTCTCGAGAAGACACGGTAAACCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001915.2-462s1c1
Sequence:CCGGGATCCTTGTCTTTGTCCTGTACTCGAGTACAGGACAAAGACAAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001915.2-123s1c1
Sequence:CCGGACTGCCTTACTACGTGGCCTTCTCGAGAAGGCCACGTAGTAAGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001915.2-357s1c1
Sequence:CCGGGCACATCTTTGCGCTCGTCATCTCGAGATGACGAGCGCAAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001915.2-556s1c1
Sequence:CCGGCGCCCACAGCACATCTTCTTTCTCGAGAAAGAAGATGTGCTGTGGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001915.3-1308s21c1
Sequence:CCGGGAGTCCCTCCAGCCTGAATAACTCGAGTTATTCAGGCTGGAGGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001915.3-694s21c1
Sequence:CCGGGGGCAAGTATAGCGCATTTGACTCGAGTCAAATGCGCTATACTTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007805
VALIDATED
CYB561 MISSION shRNA Bacterial Glycerol Stock
cytochrome b561
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000127044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007805.2-2276s1c1
Sequence:CCGGGCCAGACTACACAGAGAATTACTCGAGTAATTCTCTGTGTAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007805.2-215s1c1
Sequence:CCGGGCATGGTCATAGGCATGATCTCTCGAGAGATCATGCCTATGACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007805.2-426s1c1
Sequence:CCGGCTTAGTCTTTGTTCTGTACTTCTCGAGAAGTACAGAACAAAGACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007805.2-220s1c1
Sequence:CCGGGTCATAGGCATGATCTTCCTTCTCGAGAAGGAAGATCATGCCTATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007805.2-415s1c1
Sequence:CCGGTGGTGTGGGATCTTAGTCTTTCTCGAGAAAGACTAAGATCCCACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007805.4-425s21c1
Sequence:CCGGCTTAGTCTTTGTTCTGTACTTCTCGAGAAGTACAGAACAAAGACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007805.4-414s21c1
Sequence:CCGGTGGTGTGGGATCTTAGTCTTTCTCGAGAAAGACTAAGATCCCACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007805.4-2275s21c1
Sequence:CCGGGCCAGACTACACAGAGAATTACTCGAGTAATTCTCTGTGTAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007805.4-219s21c1
Sequence:CCGGGTCATAGGCATGATCTTCCTTCTCGAGAAGGAAGATCATGCCTATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007805
VALIDATED
CYB561 MISSION shRNA shRNA Plasmid DNA
cytochrome b561
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000127044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007805.2-2276s1c1
Sequence:CCGGGCCAGACTACACAGAGAATTACTCGAGTAATTCTCTGTGTAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007805.2-215s1c1
Sequence:CCGGGCATGGTCATAGGCATGATCTCTCGAGAGATCATGCCTATGACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007805.2-426s1c1
Sequence:CCGGCTTAGTCTTTGTTCTGTACTTCTCGAGAAGTACAGAACAAAGACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007805.2-220s1c1
Sequence:CCGGGTCATAGGCATGATCTTCCTTCTCGAGAAGGAAGATCATGCCTATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007805.2-415s1c1
Sequence:CCGGTGGTGTGGGATCTTAGTCTTTCTCGAGAAAGACTAAGATCCCACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007805.4-425s21c1
Sequence:CCGGCTTAGTCTTTGTTCTGTACTTCTCGAGAAGTACAGAACAAAGACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007805.4-414s21c1
Sequence:CCGGTGGTGTGGGATCTTAGTCTTTCTCGAGAAAGACTAAGATCCCACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007805.4-2275s21c1
Sequence:CCGGGCCAGACTACACAGAGAATTACTCGAGTAATTCTCTGTGTAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007805.4-219s21c1
Sequence:CCGGGTCATAGGCATGATCTTCCTTCTCGAGAAGGAAGATCATGCCTATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007805
VALIDATED
CYB561 MISSION shRNA Lentiviral Transduction Particles
cytochrome b561
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000127044    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007805.2-2276s1c1
Sequence:CCGGGCCAGACTACACAGAGAATTACTCGAGTAATTCTCTGTGTAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007805.2-215s1c1
Sequence:CCGGGCATGGTCATAGGCATGATCTCTCGAGAGATCATGCCTATGACCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007805.2-426s1c1
Sequence:CCGGCTTAGTCTTTGTTCTGTACTTCTCGAGAAGTACAGAACAAAGACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007805.2-220s1c1
Sequence:CCGGGTCATAGGCATGATCTTCCTTCTCGAGAAGGAAGATCATGCCTATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007805.2-415s1c1
Sequence:CCGGTGGTGTGGGATCTTAGTCTTTCTCGAGAAAGACTAAGATCCCACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007805.4-425s21c1
Sequence:CCGGCTTAGTCTTTGTTCTGTACTTCTCGAGAAGTACAGAACAAAGACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007805.4-414s21c1
Sequence:CCGGTGGTGTGGGATCTTAGTCTTTCTCGAGAAAGACTAAGATCCCACACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325384    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007805.4-2275s21c1
Sequence:CCGGGCCAGACTACACAGAGAATTACTCGAGTAATTCTCTGTGTAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007805.4-219s21c1
Sequence:CCGGGTCATAGGCATGATCTTCCTTCTCGAGAAGGAAGATCATGCCTATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks