EMAIL THIS PAGE TO A FRIEND

CYB561A3

cytochrome b561 family, member A3

50 Gene Product Result for
Synonyms: CYBASC3 LCYTB
UniProtKB ID: Q8NBI2, B3KPU2, B4DLN9, J3KQH4, Q6PK96
Gene ID:
Mouse(225912) cytochrome b561 family, member A3
Rat(361729) cytochrome b561 family, member A3
cow(615893) cytochrome b, ascorbate dependent 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153611 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153611 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153611 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201351 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201351 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201351 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153611 Rosetta Predictions human pricing
NM_001014164 Rosetta Predictions rat pricing
NM_201351 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153611 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146536 predicted 1151
2 SASI_Hs02_00367348 predicted 1125
3 SASI_Hs01_00146537 predicted 1142
4 SASI_Hs01_00146538 predicted 704
5 SASI_Hs01_00146540 predicted 678
6 SASI_Hs01_00146541 predicted 1153
7 SASI_Hs01_00146542 predicted 718
8 SASI_Hs02_00367349 predicted 1136
9 SASI_Hs02_00367350 predicted 631
10 SASI_Hs01_00146543 predicted 743
11 SASI_Hs01_00146539 predicted 958
12 SASI_Hs01_00146544 predicted 962
13 SASI_Hs01_00146545 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014164 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063999 predicted 733
2 SASI_Rn01_00064000 predicted 1448
3 SASI_Rn01_00064001 predicted 504
4 SASI_Rn01_00064002 predicted 320
5 SASI_Rn01_00064004 predicted 311
6 SASI_Rn01_00064005 predicted 840
7 SASI_Rn02_00201653 predicted 435
8 SASI_Rn01_00064006 predicted 730
9 SASI_Rn01_00064007 predicted 504
10 SASI_Rn01_00064008 predicted 795
11 SASI_Rn01_00064003 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201351 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194560 predicted 734
2 SASI_Mm02_00351504 predicted 1473
3 SASI_Mm01_00194561 predicted 859
4 SASI_Mm01_00194562 predicted 800
5 SASI_Mm02_00351505 predicted 1451
6 SASI_Mm01_00194564 predicted 1589
7 SASI_Mm01_00194565 predicted 857
8 SASI_Mm01_00194566 predicted 1071
9 SASI_Mm01_00194567 predicted 1339
10 SASI_Mm01_00194568 predicted 1200
11 SASI_Mm01_00194559 predicted 1197
12 SASI_Mm01_00194563 predicted 1418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153611
VALIDATED
CYB561A3 MISSION shRNA Bacterial Glycerol Stock
cytochrome b561 family, member A3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153611.4-789s21c1
Sequence:CCGGATGTTCAACTGGCACCCAGTGCTCGAGCACTGGGTGCCAGTTGAACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153611.4-1858s21c1
Sequence:CCGGAGTGCAGTCCACGGTGTGAAACTCGAGTTTCACACCGTGGACTGCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153611.4-887s21c1
Sequence:CCGGCAAACTGCCCTGGAAACTCCTCTCGAGAGGAGTTTCCAGGGCAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153611.4-767s21c1
Sequence:CCGGTGCCTGGAATGGCAGCATCTACTCGAGTAGATGCTGCCATTCCAGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153611.4-816s21c1
Sequence:CCGGGTTGCTGGCATGGTGGTATTCCTCGAGGAATACCACCATGCCAGCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153611.4-1476s21c1
Sequence:CCGGTGGTTTCAGCAGGCGACTTTCCTCGAGGAAAGTCGCCTGCTGAAACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153611.4-1804s21c1
Sequence:CCGGTCAGACTGATTTCCTCTTAAGCTCGAGCTTAAGAGGAAATCAGTCTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153611.4-994s21c1
Sequence:CCGGCCAACCTCTACTCCCTTCACACTCGAGTGTGAAGGGAGTAGAGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153611.2-535s1c1
Sequence:CCGGCCTCTTCACTATCTACTGGATCTCGAGATCCAGTAGATAGTGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153611.2-1123s1c1
Sequence:CCGGCCTTCTGGCTTCATCTTGGAACTCGAGTTCCAAGATGAAGCCAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153611.2-978s1c1
Sequence:CCGGCATCCGTCATTTCGGGCATTACTCGAGTAATGCCCGAAATGACGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153611.2-764s1c1
Sequence:CCGGCTGGTTGCTGTCTTTACGTTTCTCGAGAAACGTAAAGACAGCAACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153611.2-990s1c1
Sequence:CCGGCGGGCATTAATGAGAAGCTTTCTCGAGAAAGCTTCTCATTAATGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153611
VALIDATED
CYB561A3 MISSION shRNA shRNA Plasmid DNA
cytochrome b561 family, member A3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153611.4-789s21c1
Sequence:CCGGATGTTCAACTGGCACCCAGTGCTCGAGCACTGGGTGCCAGTTGAACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153611.4-1858s21c1
Sequence:CCGGAGTGCAGTCCACGGTGTGAAACTCGAGTTTCACACCGTGGACTGCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153611.4-887s21c1
Sequence:CCGGCAAACTGCCCTGGAAACTCCTCTCGAGAGGAGTTTCCAGGGCAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153611.4-767s21c1
Sequence:CCGGTGCCTGGAATGGCAGCATCTACTCGAGTAGATGCTGCCATTCCAGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153611.4-816s21c1
Sequence:CCGGGTTGCTGGCATGGTGGTATTCCTCGAGGAATACCACCATGCCAGCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153611.4-1476s21c1
Sequence:CCGGTGGTTTCAGCAGGCGACTTTCCTCGAGGAAAGTCGCCTGCTGAAACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153611.4-1804s21c1
Sequence:CCGGTCAGACTGATTTCCTCTTAAGCTCGAGCTTAAGAGGAAATCAGTCTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153611.4-994s21c1
Sequence:CCGGCCAACCTCTACTCCCTTCACACTCGAGTGTGAAGGGAGTAGAGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153611.2-535s1c1
Sequence:CCGGCCTCTTCACTATCTACTGGATCTCGAGATCCAGTAGATAGTGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153611.2-1123s1c1
Sequence:CCGGCCTTCTGGCTTCATCTTGGAACTCGAGTTCCAAGATGAAGCCAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153611.2-978s1c1
Sequence:CCGGCATCCGTCATTTCGGGCATTACTCGAGTAATGCCCGAAATGACGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153611.2-764s1c1
Sequence:CCGGCTGGTTGCTGTCTTTACGTTTCTCGAGAAACGTAAAGACAGCAACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153611.2-990s1c1
Sequence:CCGGCGGGCATTAATGAGAAGCTTTCTCGAGAAAGCTTCTCATTAATGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153611
VALIDATED
CYB561A3 MISSION shRNA Lentiviral Transduction Particles
cytochrome b561 family, member A3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153611.4-789s21c1
Sequence:CCGGATGTTCAACTGGCACCCAGTGCTCGAGCACTGGGTGCCAGTTGAACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435880    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153611.4-1858s21c1
Sequence:CCGGAGTGCAGTCCACGGTGTGAAACTCGAGTTTCACACCGTGGACTGCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153611.4-887s21c1
Sequence:CCGGCAAACTGCCCTGGAAACTCCTCTCGAGAGGAGTTTCCAGGGCAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153611.4-767s21c1
Sequence:CCGGTGCCTGGAATGGCAGCATCTACTCGAGTAGATGCTGCCATTCCAGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153611.4-816s21c1
Sequence:CCGGGTTGCTGGCATGGTGGTATTCCTCGAGGAATACCACCATGCCAGCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153611.4-1476s21c1
Sequence:CCGGTGGTTTCAGCAGGCGACTTTCCTCGAGGAAAGTCGCCTGCTGAAACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153611.4-1804s21c1
Sequence:CCGGTCAGACTGATTTCCTCTTAAGCTCGAGCTTAAGAGGAAATCAGTCTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153611.4-994s21c1
Sequence:CCGGCCAACCTCTACTCCCTTCACACTCGAGTGTGAAGGGAGTAGAGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153611.2-535s1c1
Sequence:CCGGCCTCTTCACTATCTACTGGATCTCGAGATCCAGTAGATAGTGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153611.2-1123s1c1
Sequence:CCGGCCTTCTGGCTTCATCTTGGAACTCGAGTTCCAAGATGAAGCCAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153611.2-978s1c1
Sequence:CCGGCATCCGTCATTTCGGGCATTACTCGAGTAATGCCCGAAATGACGGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_153611.2-764s1c1
Sequence:CCGGCTGGTTGCTGTCTTTACGTTTCTCGAGAAACGTAAAGACAGCAACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153611.2-990s1c1
Sequence:CCGGCGGGCATTAATGAGAAGCTTTCTCGAGAAAGCTTCTCATTAATGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201351
VALIDATED
CYB561A3 MISSION shRNA Bacterial Glycerol Stock
cytochrome b561 family, member A3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201351.1-1078s21c1
Sequence:CCGGCTGTTATTTCCGGCATCAATGCTCGAGCATTGATGCCGGAAATAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201351.1-1944s21c1
Sequence:CCGGGTAGCATGACGAGCCGTTAAACTCGAGTTTAACGGCTCGTCATGCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201351.1-684s21c1
Sequence:CCGGGGCACGGTGCTCATGTTTAACCTCGAGGTTAAACATGAGCACCGTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201351.1-1022s21c1
Sequence:CCGGCCTGAAACCTCTGCATGTATTCTCGAGAATACATGCAGAGGTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201351.1-862s21c1
Sequence:CCGGTGATTGCCGTCTTTCGGTTTCCTCGAGGAAACCGAAAGACGGCAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201351
VALIDATED
CYB561A3 MISSION shRNA shRNA Plasmid DNA
cytochrome b561 family, member A3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201351.1-1078s21c1
Sequence:CCGGCTGTTATTTCCGGCATCAATGCTCGAGCATTGATGCCGGAAATAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201351.1-1944s21c1
Sequence:CCGGGTAGCATGACGAGCCGTTAAACTCGAGTTTAACGGCTCGTCATGCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201351.1-684s21c1
Sequence:CCGGGGCACGGTGCTCATGTTTAACCTCGAGGTTAAACATGAGCACCGTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201351.1-1022s21c1
Sequence:CCGGCCTGAAACCTCTGCATGTATTCTCGAGAATACATGCAGAGGTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201351.1-862s21c1
Sequence:CCGGTGATTGCCGTCTTTCGGTTTCCTCGAGGAAACCGAAAGACGGCAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201351
VALIDATED
CYB561A3 MISSION shRNA Lentiviral Transduction Particles
cytochrome b561 family, member A3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201351.1-1078s21c1
Sequence:CCGGCTGTTATTTCCGGCATCAATGCTCGAGCATTGATGCCGGAAATAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241745    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201351.1-1944s21c1
Sequence:CCGGGTAGCATGACGAGCCGTTAAACTCGAGTTTAACGGCTCGTCATGCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201351.1-684s21c1
Sequence:CCGGGGCACGGTGCTCATGTTTAACCTCGAGGTTAAACATGAGCACCGTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201351.1-1022s21c1
Sequence:CCGGCCTGAAACCTCTGCATGTATTCTCGAGAATACATGCAGAGGTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_201351.1-862s21c1
Sequence:CCGGTGATTGCCGTCTTTCGGTTTCCTCGAGGAAACCGAAAGACGGCAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)