EMAIL THIS PAGE TO A FRIEND

CYB561D1

cytochrome b561 family, member D1

186 Gene Product Result for
UniProtKB ID: Q8N8Q1, B4DH97, E9PCM8, Q52M36, Q5T6C2, Q5T6C3
Gene ID:
Mouse(72023) cytochrome b-561 domain containing 1
Rat(362017) cytochrome b561 family, member D1
Zebrafish(447851) cytochrome b-561 domain containing 1
cow(527518) cytochrome b-561 domain containing 1
dog(611824) cytochrome b-561 domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182580 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182580 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182580 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081320 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081320 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081320 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182580 Rosetta Predictions human pricing
NM_001108562 Rosetta Predictions rat pricing
NM_001081320 Rosetta Predictions mouse pricing
NM_028061 Rosetta Predictions mouse pricing
XM_893050 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182580 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093108 predicted 770
2 SASI_Hs01_00093109 predicted 538
3 SASI_Hs01_00093110 predicted 722
4 SASI_Hs01_00093111 predicted 668
5 SASI_Hs01_00093112 predicted 574
6 SASI_Hs01_00093113 predicted 396
7 SASI_Hs01_00093114 predicted 774
8 SASI_Hs01_00093115 predicted 783
9 SASI_Hs01_00093116 predicted 592
10 SASI_Hs01_00093117 predicted 517
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108562 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239859 predicted 575
2 SASI_Rn02_00239860 predicted 363
3 SASI_Rn02_00239861 predicted 1264
4 SASI_Rn02_00239862 predicted 770
5 SASI_Rn02_00239863 predicted 560
6 SASI_Rn02_00239864 predicted 293
7 SASI_Rn02_00239865 predicted 610
8 SASI_Rn02_00239866 predicted 742
9 SASI_Rn02_00239867 predicted 279
10 SASI_Rn02_00239868 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081320 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297261 predicted 613
2 SASI_Mm02_00297262 predicted 776
3 SASI_Mm02_00297263 predicted 707
4 SASI_Mm02_00297264 predicted 652
5 SASI_Mm02_00297265 predicted 774
6 SASI_Mm02_00297266 predicted 637
7 SASI_Mm02_00297267 predicted 738
8 SASI_Mm02_00297268 predicted 422
9 SASI_Mm02_00297269 predicted 758
10 SASI_Mm02_00297270 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028061 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333255 predicted 481
2 SASI_Mm02_00333256 predicted 639
3 SASI_Mm02_00333257 predicted 582
4 SASI_Mm02_00333258 predicted 522
5 SASI_Mm02_00333259 predicted 641
6 SASI_Mm02_00333260 predicted 510
7 SASI_Mm02_00333261 predicted 608
8 SASI_Mm02_00333262 predicted 285
9 SASI_Mm02_00333263 predicted 627
10 SASI_Mm02_00333264 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_893050 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232698 predicted 351
2 SASI_Mm01_00232699 predicted 619
3 SASI_Mm01_00232700 predicted 780
4 SASI_Mm01_00232701 predicted 654
5 SASI_Mm01_00232702 predicted 741
6 SASI_Mm01_00232703 predicted 490
7 SASI_Mm01_00232704 predicted 260
8 SASI_Mm01_00232705 predicted 289
9 SASI_Mm01_00232706 predicted 367
10 SASI_Mm01_00232707 predicted 762
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182580
VALIDATED
CYB561D1 MISSION shRNA Bacterial Glycerol Stock
cytochrome b561 family, member D1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_182580.1-584s1c1
Sequence:CCGGCTTCTGGGCATGTACTCAGTACTCGAGTACTGAGTACATGCCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182580.1-685s1c1
Sequence:CCGGCCAGATTTCCAGATCCTACTTCTCGAGAAGTAGGATCTGGAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_182580.1-518s1c1
Sequence:CCGGGCTCGCCTCAAGCTCTACCATCTCGAGATGGTAGAGCTTGAGGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182580.1-253s1c1
Sequence:CCGGCCTACTCTTCTCACCTGAACACTCGAGTGTTCAGGTGAGAAGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182580.1-202s1c1
Sequence:CCGGGCACCCTGTATTCATGGCCTTCTCGAGAAGGCCATGAATACAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-174s21c1
Sequence:CCGGCCATCTTTCTGACAGCGCTGTCTCGAGACAGCGCTGTCAGAAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-624s21c1
Sequence:CCGGTATGGTTCCAGGCCCAGATCACTCGAGTGATCTGGGCCTGGAACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-292s21c1
Sequence:CCGGACACTCCCTGTTCTTCTTCTGCTCGAGCAGAAGAAGAACAGGGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-751s21c1
Sequence:CCGGAGTTCCTGCGAACGCTGAATCCTCGAGGATTCAGCGTTCGCAGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182580.2-800s21c1
Sequence:CCGGGGTTCCTTTGGTGATCTATAACTCGAGTTATAGATCACCAAAGGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-588s21c1
Sequence:CCGGTGGCTACAGTAACGGTGCTTCCTCGAGGAAGCACCGTTACTGTAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-562s21c1
Sequence:CCGGGACATGTGGACTGGTGGTCTACTCGAGTAGACCACCAGTCCACATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182580.2-812s21c1
Sequence:CCGGGATCTATAAGGGATCTATTTACTCGAGTAAATAGATCCCTTATAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-550s21c1
Sequence:CCGGGCTCTACCATCTGACATGTGGCTCGAGCCACATGTCAGATGGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-153s21c1
Sequence:CCGGACCTGGTAGCTTTGGGCTTCACTCGAGTGAAGCCCAAAGCTACCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182580
VALIDATED
CYB561D1 MISSION shRNA shRNA Plasmid DNA
cytochrome b561 family, member D1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_182580.1-584s1c1
Sequence:CCGGCTTCTGGGCATGTACTCAGTACTCGAGTACTGAGTACATGCCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182580.1-685s1c1
Sequence:CCGGCCAGATTTCCAGATCCTACTTCTCGAGAAGTAGGATCTGGAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_182580.1-518s1c1
Sequence:CCGGGCTCGCCTCAAGCTCTACCATCTCGAGATGGTAGAGCTTGAGGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182580.1-253s1c1
Sequence:CCGGCCTACTCTTCTCACCTGAACACTCGAGTGTTCAGGTGAGAAGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182580.1-202s1c1
Sequence:CCGGGCACCCTGTATTCATGGCCTTCTCGAGAAGGCCATGAATACAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-174s21c1
Sequence:CCGGCCATCTTTCTGACAGCGCTGTCTCGAGACAGCGCTGTCAGAAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-624s21c1
Sequence:CCGGTATGGTTCCAGGCCCAGATCACTCGAGTGATCTGGGCCTGGAACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-292s21c1
Sequence:CCGGACACTCCCTGTTCTTCTTCTGCTCGAGCAGAAGAAGAACAGGGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-751s21c1
Sequence:CCGGAGTTCCTGCGAACGCTGAATCCTCGAGGATTCAGCGTTCGCAGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182580.2-800s21c1
Sequence:CCGGGGTTCCTTTGGTGATCTATAACTCGAGTTATAGATCACCAAAGGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-588s21c1
Sequence:CCGGTGGCTACAGTAACGGTGCTTCCTCGAGGAAGCACCGTTACTGTAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-562s21c1
Sequence:CCGGGACATGTGGACTGGTGGTCTACTCGAGTAGACCACCAGTCCACATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182580.2-812s21c1
Sequence:CCGGGATCTATAAGGGATCTATTTACTCGAGTAAATAGATCCCTTATAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-550s21c1
Sequence:CCGGGCTCTACCATCTGACATGTGGCTCGAGCCACATGTCAGATGGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-153s21c1
Sequence:CCGGACCTGGTAGCTTTGGGCTTCACTCGAGTGAAGCCCAAAGCTACCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182580
VALIDATED
CYB561D1 MISSION shRNA Lentiviral Transduction Particles
cytochrome b561 family, member D1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_182580.1-584s1c1
Sequence:CCGGCTTCTGGGCATGTACTCAGTACTCGAGTACTGAGTACATGCCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182580.1-685s1c1
Sequence:CCGGCCAGATTTCCAGATCCTACTTCTCGAGAAGTAGGATCTGGAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_182580.1-518s1c1
Sequence:CCGGGCTCGCCTCAAGCTCTACCATCTCGAGATGGTAGAGCTTGAGGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182580.1-253s1c1
Sequence:CCGGCCTACTCTTCTCACCTGAACACTCGAGTGTTCAGGTGAGAAGAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182580.1-202s1c1
Sequence:CCGGGCACCCTGTATTCATGGCCTTCTCGAGAAGGCCATGAATACAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-174s21c1
Sequence:CCGGCCATCTTTCTGACAGCGCTGTCTCGAGACAGCGCTGTCAGAAAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-624s21c1
Sequence:CCGGTATGGTTCCAGGCCCAGATCACTCGAGTGATCTGGGCCTGGAACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-292s21c1
Sequence:CCGGACACTCCCTGTTCTTCTTCTGCTCGAGCAGAAGAAGAACAGGGAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-751s21c1
Sequence:CCGGAGTTCCTGCGAACGCTGAATCCTCGAGGATTCAGCGTTCGCAGGAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412447    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182580.2-800s21c1
Sequence:CCGGGGTTCCTTTGGTGATCTATAACTCGAGTTATAGATCACCAAAGGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-588s21c1
Sequence:CCGGTGGCTACAGTAACGGTGCTTCCTCGAGGAAGCACCGTTACTGTAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-562s21c1
Sequence:CCGGGACATGTGGACTGGTGGTCTACTCGAGTAGACCACCAGTCCACATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182580.2-812s21c1
Sequence:CCGGGATCTATAAGGGATCTATTTACTCGAGTAAATAGATCCCTTATAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-550s21c1
Sequence:CCGGGCTCTACCATCTGACATGTGGCTCGAGCCACATGTCAGATGGTAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182580.2-153s21c1
Sequence:CCGGACCTGGTAGCTTTGGGCTTCACTCGAGTGAAGCCCAAAGCTACCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081320
CYB561D1 MISSION shRNA Bacterial Glycerol Stock
cytochrome b561 family, member D1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081320.2-145s21c1
Sequence:CCGGTTGGCGCACCTGATAGCTTTGCTCGAGCAAAGCTATCAGGTGCGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081320.2-408s21c1
Sequence:CCGGCCGAAGTGAGATGTCCCATTTCTCGAGAAATGGGACATCTCACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081320.2-3189s21c1
Sequence:CCGGTGTTCCAAGCTTGACTATATTCTCGAGAATATAGTCAAGCTTGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081320.2-377s21c1
Sequence:CCGGTAGGCTTGGGCTTCATCATTTCTCGAGAAATGATGAAGCCCAAGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081320.2-579s21c1
Sequence:CCGGCTACCTGATGGCTACAGTAACCTCGAGGTTACTGTAGCCATCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081320
CYB561D1 MISSION shRNA shRNA Plasmid DNA
cytochrome b561 family, member D1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081320.2-145s21c1
Sequence:CCGGTTGGCGCACCTGATAGCTTTGCTCGAGCAAAGCTATCAGGTGCGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081320.2-408s21c1
Sequence:CCGGCCGAAGTGAGATGTCCCATTTCTCGAGAAATGGGACATCTCACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081320.2-3189s21c1
Sequence:CCGGTGTTCCAAGCTTGACTATATTCTCGAGAATATAGTCAAGCTTGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081320.2-377s21c1
Sequence:CCGGTAGGCTTGGGCTTCATCATTTCTCGAGAAATGATGAAGCCCAAGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081320.2-579s21c1
Sequence:CCGGCTACCTGATGGCTACAGTAACCTCGAGGTTACTGTAGCCATCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081320
CYB561D1 MISSION shRNA Lentiviral Transduction Particles
cytochrome b561 family, member D1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081320.2-145s21c1
Sequence:CCGGTTGGCGCACCTGATAGCTTTGCTCGAGCAAAGCTATCAGGTGCGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081320.2-408s21c1
Sequence:CCGGCCGAAGTGAGATGTCCCATTTCTCGAGAAATGGGACATCTCACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254235    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081320.2-3189s21c1
Sequence:CCGGTGTTCCAAGCTTGACTATATTCTCGAGAATATAGTCAAGCTTGGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081320.2-377s21c1
Sequence:CCGGTAGGCTTGGGCTTCATCATTTCTCGAGAAATGATGAAGCCCAAGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081320.2-579s21c1
Sequence:CCGGCTACCTGATGGCTACAGTAACCTCGAGGTTACTGTAGCCATCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks