EMAIL THIS PAGE TO A FRIEND

CYB561D2

cytochrome b561 family, member D2

46 Gene Product Result for
Synonyms: 101F6 TSP10
UniProtKB ID: O14569, A8K552
Gene ID:
Mouse(56368) cytochrome b-561 domain containing 2
Rat(363137) cytochrome b561 family, member D2
Zebrafish(450082) cytochrome b-561 domain containing 2
chicken(100857844) cytochrome b-561 domain containing 2
cow(523966) cytochrome b-561 domain containing 2
dog(484759) cytochrome b-561 domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007022 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007022 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007022 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019720 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019720 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019720 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007022 Rosetta Predictions human pricing
NM_001007753 Rosetta Predictions rat pricing
NM_019720 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007022 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041367 predicted 836
2 SASI_Hs02_00342785 predicted 207
3 SASI_Hs01_00041368 predicted 810
4 SASI_Hs01_00041369 predicted 664
5 SASI_Hs01_00041370 predicted 803
6 SASI_Hs01_00041371 predicted 810
7 SASI_Hs01_00041372 predicted 775
8 SASI_Hs01_00041373 predicted 686
9 SASI_Hs01_00041374 predicted 939
10 SASI_Hs01_00041375 predicted 509
11 SASI_Hs01_00041376 predicted 528
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041317 predicted 586
2 SASI_Rn01_00041318 predicted 589
3 SASI_Rn01_00041319 predicted 1110
4 SASI_Rn01_00041320 predicted 1106
5 SASI_Rn01_00041321 predicted 623
6 SASI_Rn01_00041322 predicted 1115
7 SASI_Rn01_00041323 predicted 689
8 SASI_Rn01_00041324 predicted 601
9 SASI_Rn01_00041325 predicted 1050
10 SASI_Rn01_00041326 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066578 predicted 1141
2 SASI_Mm02_00324844 predicted 1129
3 SASI_Mm01_00066579 predicted 1138
4 SASI_Mm01_00066580 predicted 1241
5 SASI_Mm01_00066582 predicted 1379
6 SASI_Mm01_00066583 predicted 1324
7 SASI_Mm02_00324845 predicted 432
8 SASI_Mm01_00066584 predicted 380
9 SASI_Mm01_00066585 predicted 427
10 SASI_Mm01_00066587 predicted 1333
11 SASI_Mm01_00066581 predicted 1164
12 SASI_Mm01_00066586 predicted 768
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007022
VALIDATED
CYB561D2 MISSION shRNA Bacterial Glycerol Stock
cytochrome b561 family, member D2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_007022.3-352s21c1
Sequence:CCGGCACCCGGTGCTTATGTCTTTGCTCGAGCAAAGACATAAGCACCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007022.3-513s21c1
Sequence:CCGGCGGCCTTGTCATCCTCCACAACTCGAGTTGTGGAGGATGACAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_007022.3-291s21c1
Sequence:CCGGCCTGGGCTTTACCATCTTTGTCTCGAGACAAAGATGGTAAAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007022.3-810s21c1
Sequence:CCGGCCTCACCAGCTTGGTCATTATCTCGAGATAATGACCAAGCTGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307322    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_007022.3-981s21c1
Sequence:CCGGCACTGGGACAGTTGGGCATTTCTCGAGAAATGCCCAACTGTCCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007022.3-810s1c1
Sequence:CCGGCCTCACCAGCTTGGTCATTATCTCGAGATAATGACCAAGCTGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007022.3-836s1c1
Sequence:CCGGAGGTGAGCAATGCCTACCTATCTCGAGATAGGTAGGCATTGCTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_007022.3-674s1c1
Sequence:CCGGTCAAGCTATACCATGCTACTTCTCGAGAAGTAGCATGGTATAGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007022.3-291s1c1
Sequence:CCGGCCTGGGCTTTACCATCTTTGTCTCGAGACAAAGATGGTAAAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007022.3-513s1c1
Sequence:CCGGCGGCCTTGTCATCCTCCACAACTCGAGTTGTGGAGGATGACAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007022
VALIDATED
CYB561D2 MISSION shRNA shRNA Plasmid DNA
cytochrome b561 family, member D2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_007022.3-352s21c1
Sequence:CCGGCACCCGGTGCTTATGTCTTTGCTCGAGCAAAGACATAAGCACCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007022.3-513s21c1
Sequence:CCGGCGGCCTTGTCATCCTCCACAACTCGAGTTGTGGAGGATGACAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_007022.3-291s21c1
Sequence:CCGGCCTGGGCTTTACCATCTTTGTCTCGAGACAAAGATGGTAAAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007022.3-810s21c1
Sequence:CCGGCCTCACCAGCTTGGTCATTATCTCGAGATAATGACCAAGCTGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307322    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_007022.3-981s21c1
Sequence:CCGGCACTGGGACAGTTGGGCATTTCTCGAGAAATGCCCAACTGTCCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007022.3-810s1c1
Sequence:CCGGCCTCACCAGCTTGGTCATTATCTCGAGATAATGACCAAGCTGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007022.3-836s1c1
Sequence:CCGGAGGTGAGCAATGCCTACCTATCTCGAGATAGGTAGGCATTGCTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_007022.3-674s1c1
Sequence:CCGGTCAAGCTATACCATGCTACTTCTCGAGAAGTAGCATGGTATAGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007022.3-291s1c1
Sequence:CCGGCCTGGGCTTTACCATCTTTGTCTCGAGACAAAGATGGTAAAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007022.3-513s1c1
Sequence:CCGGCGGCCTTGTCATCCTCCACAACTCGAGTTGTGGAGGATGACAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007022
VALIDATED
CYB561D2 MISSION shRNA Lentiviral Transduction Particles
cytochrome b561 family, member D2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_007022.3-352s21c1
Sequence:CCGGCACCCGGTGCTTATGTCTTTGCTCGAGCAAAGACATAAGCACCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007022.3-513s21c1
Sequence:CCGGCGGCCTTGTCATCCTCCACAACTCGAGTTGTGGAGGATGACAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_007022.3-291s21c1
Sequence:CCGGCCTGGGCTTTACCATCTTTGTCTCGAGACAAAGATGGTAAAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007022.3-810s21c1
Sequence:CCGGCCTCACCAGCTTGGTCATTATCTCGAGATAATGACCAAGCTGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307322    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_007022.3-981s21c1
Sequence:CCGGCACTGGGACAGTTGGGCATTTCTCGAGAAATGCCCAACTGTCCCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034274    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007022.3-810s1c1
Sequence:CCGGCCTCACCAGCTTGGTCATTATCTCGAGATAATGACCAAGCTGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007022.3-836s1c1
Sequence:CCGGAGGTGAGCAATGCCTACCTATCTCGAGATAGGTAGGCATTGCTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_007022.3-674s1c1
Sequence:CCGGTCAAGCTATACCATGCTACTTCTCGAGAAGTAGCATGGTATAGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007022.3-291s1c1
Sequence:CCGGCCTGGGCTTTACCATCTTTGTCTCGAGACAAAGATGGTAAAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007022.3-513s1c1
Sequence:CCGGCGGCCTTGTCATCCTCCACAACTCGAGTTGTGGAGGATGACAAGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019720
VALIDATED
CYB561D2 MISSION shRNA Bacterial Glycerol Stock
cytochrome b561 family, member D2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019720.4-877s21c1
Sequence:CCGGATGCCTACCTGTACCGCAAGACTCGAGTCTTGCGGTACAGGTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019720.4-436s21c1
Sequence:CCGGTGATGTTCTCTCCTGAGAGTTCTCGAGAACTCTCAGGAGAGAACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019720.4-767s21c1
Sequence:CCGGGTTGGGCATGTTCTCACTCTGCTCGAGCAGAGTGAGAACATGCCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019720.4-908s21c1
Sequence:CCGGATGAGCACTCACCAGTTATTACTCGAGTAATAACTGGTGAGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019720.4-1133s21c1
Sequence:CCGGAGCAGCCATACAGCTTATATTCTCGAGAATATAAGCTGTATGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019720.2-390s1c1
Sequence:CCGGCGTTCTTATGTCTCTGGCTTTCTCGAGAAAGCCAGAGACATAAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019720.2-696s1c1
Sequence:CCGGCCTGGCAAAGCTGAAACTCTACTCGAGTAGAGTTTCAGCTTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019720.2-546s1c1
Sequence:CCGGAGGTCTTGTCATCCTCCACAACTCGAGTTGTGGAGGATGACAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019720.2-322s1c1
Sequence:CCGGGCGTTAGGCTTTACCATCTTTCTCGAGAAAGATGGTAAAGCCTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019720.2-843s1c1
Sequence:CCGGCCTCACCAGTTTGGTAATCATCTCGAGATGATTACCAAACTGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019720
VALIDATED
CYB561D2 MISSION shRNA shRNA Plasmid DNA
cytochrome b561 family, member D2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019720.4-877s21c1
Sequence:CCGGATGCCTACCTGTACCGCAAGACTCGAGTCTTGCGGTACAGGTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019720.4-436s21c1
Sequence:CCGGTGATGTTCTCTCCTGAGAGTTCTCGAGAACTCTCAGGAGAGAACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019720.4-767s21c1
Sequence:CCGGGTTGGGCATGTTCTCACTCTGCTCGAGCAGAGTGAGAACATGCCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019720.4-908s21c1
Sequence:CCGGATGAGCACTCACCAGTTATTACTCGAGTAATAACTGGTGAGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019720.4-1133s21c1
Sequence:CCGGAGCAGCCATACAGCTTATATTCTCGAGAATATAAGCTGTATGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019720.2-390s1c1
Sequence:CCGGCGTTCTTATGTCTCTGGCTTTCTCGAGAAAGCCAGAGACATAAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019720.2-696s1c1
Sequence:CCGGCCTGGCAAAGCTGAAACTCTACTCGAGTAGAGTTTCAGCTTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019720.2-546s1c1
Sequence:CCGGAGGTCTTGTCATCCTCCACAACTCGAGTTGTGGAGGATGACAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019720.2-322s1c1
Sequence:CCGGGCGTTAGGCTTTACCATCTTTCTCGAGAAAGATGGTAAAGCCTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019720.2-843s1c1
Sequence:CCGGCCTCACCAGTTTGGTAATCATCTCGAGATGATTACCAAACTGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019720
VALIDATED
CYB561D2 MISSION shRNA Lentiviral Transduction Particles
cytochrome b561 family, member D2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019720.4-877s21c1
Sequence:CCGGATGCCTACCTGTACCGCAAGACTCGAGTCTTGCGGTACAGGTAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019720.4-436s21c1
Sequence:CCGGTGATGTTCTCTCCTGAGAGTTCTCGAGAACTCTCAGGAGAGAACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019720.4-767s21c1
Sequence:CCGGGTTGGGCATGTTCTCACTCTGCTCGAGCAGAGTGAGAACATGCCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019720.4-908s21c1
Sequence:CCGGATGAGCACTCACCAGTTATTACTCGAGTAATAACTGGTGAGTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019720.4-1133s21c1
Sequence:CCGGAGCAGCCATACAGCTTATATTCTCGAGAATATAAGCTGTATGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054803    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019720.2-390s1c1
Sequence:CCGGCGTTCTTATGTCTCTGGCTTTCTCGAGAAAGCCAGAGACATAAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019720.2-696s1c1
Sequence:CCGGCCTGGCAAAGCTGAAACTCTACTCGAGTAGAGTTTCAGCTTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019720.2-546s1c1
Sequence:CCGGAGGTCTTGTCATCCTCCACAACTCGAGTTGTGGAGGATGACAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019720.2-322s1c1
Sequence:CCGGGCGTTAGGCTTTACCATCTTTCTCGAGAAAGATGGTAAAGCCTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019720.2-843s1c1
Sequence:CCGGCCTCACCAGTTTGGTAATCATCTCGAGATGATTACCAAACTGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks