EMAIL THIS PAGE TO A FRIEND

CYB5A

cytochrome b5 type A (microsomal)

Synonyms: CYB5 MCB5
UniProtKB ID: P00167, A8MV91, F8WEU4, Q6IB14
Gene ID:
Human(1528) Summary: The protein encoded by this gene is a membrane-bound cytochrome that reduces ferric hemoglobin (methemoglobin) to ferrous hemoglobin, which is required for stearyl-CoA-desaturase activity. Defects in this gene are a cause of type IV hereditary methemoglobinemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Rat(64001) cytochrome b5 type A (microsomal)
Zebrafish(406409) cytochrome b5 type A (microsomal)
cow(281110) cytochrome b5 type A (microsomal)
cow(100335454) cytochrome b5 type A (microsomal)
Horse(100052210) cytochrome b5 type A (microsomal)
dog(476167) cytochrome b5 type A (microsomal)
chicken(414798) cytochrome b5 type A (microsomal)
Goat(100861011) cytochrome b5
sheep(100307037) cytochrome b5 type A (microsomal)
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001914 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001914 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001914 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092461 MISSION® esiRNA esiRNA human CYB5A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001914 Rosetta Predictions human pricing
NM_148923 Rosetta Predictions human pricing
NM_022245 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159892 predicted 427
2 SASI_Hs02_00332793 predicted 568
3 SASI_Hs02_00332794 predicted 592
4 SASI_Hs01_00159894 predicted 385
5 SASI_Hs01_00159895 predicted 563
6 SASI_Hs01_00159897 predicted 360
7 SASI_Hs01_00159898 predicted 412
8 SASI_Hs01_00159899 predicted 379
9 SASI_Hs01_00159900 predicted 601
10 SASI_Hs02_00332795 predicted 498
11 SASI_Hs01_00159893 predicted 430
12 SASI_Hs01_00159896 predicted 316
13 SASI_Hs01_00159901 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148923 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189378 predicted 549
2 SASI_Hs02_00365655 predicted 573
3 SASI_Hs01_00189379 predicted 380
4 SASI_Hs01_00189380 predicted 546
5 SASI_Hs01_00189381 predicted 390
6 SASI_Hs01_00189384 predicted 357
7 SASI_Hs01_00189385 predicted 574
8 SASI_Hs01_00189386 predicted 398
9 SASI_Hs02_00365656 predicted 476
10 SASI_Hs02_00365657 predicted 476
11 SASI_Hs01_00189382 predicted 405
12 SASI_Hs01_00189383 predicted 312
13 SASI_Hs01_00189387 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022245 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111529 predicted 277
2 SASI_Rn01_00111530 predicted 474
3 SASI_Rn01_00111531 predicted 311
4 SASI_Rn01_00111532 predicted 335
5 SASI_Rn01_00111534 predicted 261
6 SASI_Rn01_00111535 predicted 423
7 SASI_Rn01_00111536 predicted 345
8 SASI_Rn01_00111537 predicted 356
9 SASI_Rn02_00263021 predicted 453
10 SASI_Rn01_00111538 predicted 263
11 SASI_Rn01_00111533 predicted 538
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001914
VALIDATED
CYB5A MISSION shRNA Bacterial Glycerol Stock
cytochrome b5 type A (microsomal)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001914.1-39s1c1
Sequence:CCGGCCTAGAGGAGATTCAGAAGCACTCGAGTGCTTCTGAATCTCCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001914.1-175s1c1
Sequence:CCGGGCTACTGAGAACTTTGAGGATCTCGAGATCCTCAAAGTTCTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001914.1-203s1c1
Sequence:CCGGACTCTACAGATGCCAGGGAAACTCGAGTTTCCCTGGCATCTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001914.1-90s1c1
Sequence:CCGGGCACCACAAGGTGTACGATTTCTCGAGAAATCGTACACCTTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001914.1-252s1c1
Sequence:CCGGCCATCCAGATGACAGACCAAACTCGAGTTTGGTCTGTCATCTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001914.2-314s21c1
Sequence:CCGGACTCTACAGATGCCAGGGAAACTCGAGTTTCCCTGGCATCTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001914.2-150s21c1
Sequence:CCGGCCTAGAGGAGATTCAGAAGCACTCGAGTGCTTCTGAATCTCCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001914.2-286s21c1
Sequence:CCGGGCTACTGAGAACTTTGAGGATCTCGAGATCCTCAAAGTTCTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001914.2-201s21c1
Sequence:CCGGGCACCACAAGGTGTACGATTTCTCGAGAAATCGTACACCTTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001914.2-363s21c1
Sequence:CCGGCCATCCAGATGACAGACCAAACTCGAGTTTGGTCTGTCATCTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001914
VALIDATED
CYB5A MISSION shRNA shRNA Plasmid DNA
cytochrome b5 type A (microsomal)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001914.1-39s1c1
Sequence:CCGGCCTAGAGGAGATTCAGAAGCACTCGAGTGCTTCTGAATCTCCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001914.1-175s1c1
Sequence:CCGGGCTACTGAGAACTTTGAGGATCTCGAGATCCTCAAAGTTCTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001914.1-203s1c1
Sequence:CCGGACTCTACAGATGCCAGGGAAACTCGAGTTTCCCTGGCATCTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001914.1-90s1c1
Sequence:CCGGGCACCACAAGGTGTACGATTTCTCGAGAAATCGTACACCTTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001914.1-252s1c1
Sequence:CCGGCCATCCAGATGACAGACCAAACTCGAGTTTGGTCTGTCATCTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001914.2-314s21c1
Sequence:CCGGACTCTACAGATGCCAGGGAAACTCGAGTTTCCCTGGCATCTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001914.2-150s21c1
Sequence:CCGGCCTAGAGGAGATTCAGAAGCACTCGAGTGCTTCTGAATCTCCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001914.2-286s21c1
Sequence:CCGGGCTACTGAGAACTTTGAGGATCTCGAGATCCTCAAAGTTCTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001914.2-201s21c1
Sequence:CCGGGCACCACAAGGTGTACGATTTCTCGAGAAATCGTACACCTTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001914.2-363s21c1
Sequence:CCGGCCATCCAGATGACAGACCAAACTCGAGTTTGGTCTGTCATCTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001914
VALIDATED
CYB5A MISSION shRNA Lentiviral Transduction Particles
cytochrome b5 type A (microsomal)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001914.1-39s1c1
Sequence:CCGGCCTAGAGGAGATTCAGAAGCACTCGAGTGCTTCTGAATCTCCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001914.1-175s1c1
Sequence:CCGGGCTACTGAGAACTTTGAGGATCTCGAGATCCTCAAAGTTCTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001914.1-203s1c1
Sequence:CCGGACTCTACAGATGCCAGGGAAACTCGAGTTTCCCTGGCATCTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001914.1-90s1c1
Sequence:CCGGGCACCACAAGGTGTACGATTTCTCGAGAAATCGTACACCTTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001914.1-252s1c1
Sequence:CCGGCCATCCAGATGACAGACCAAACTCGAGTTTGGTCTGTCATCTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001914.2-314s21c1
Sequence:CCGGACTCTACAGATGCCAGGGAAACTCGAGTTTCCCTGGCATCTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001914.2-150s21c1
Sequence:CCGGCCTAGAGGAGATTCAGAAGCACTCGAGTGCTTCTGAATCTCCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001914.2-286s21c1
Sequence:CCGGGCTACTGAGAACTTTGAGGATCTCGAGATCCTCAAAGTTCTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_001914.2-201s21c1
Sequence:CCGGGCACCACAAGGTGTACGATTTCTCGAGAAATCGTACACCTTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001914.2-363s21c1
Sequence:CCGGCCATCCAGATGACAGACCAAACTCGAGTTTGGTCTGTCATCTGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks