EMAIL THIS PAGE TO A FRIEND

CYB5B

cytochrome b5 type B (outer mitochondrial membrane)

Synonyms: CYB5-M CYPB5M OMB5
UniProtKB ID: O43169, A8K6B1, Q96CC3, Q9BT35
Gene ID:
Mouse(66427) cytochrome b5 type B
Rat(80773) cytochrome b5 type B (outer mitochondrial membrane)
Zebrafish(405812) cytochrome b5 type B
dog(610942) cytochrome b5 type B (outer mitochondrial membrane)
cow(506370) cytochrome b5 type B (outer mitochondrial membrane)
chicken(415865) outer mitochondrial membrane cytochrome b5
260 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025558 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025558 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025558 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_030579 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030579 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030579 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030579 Rosetta Predictions human pricing
NM_030586 Rosetta Predictions rat pricing
NM_025558 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030579 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210409 predicted 346
2 SASI_Hs01_00210410 predicted 298
3 SASI_Hs01_00210411 predicted 358
4 SASI_Hs01_00210412 predicted 650
5 SASI_Hs01_00210413 predicted 390
6 SASI_Hs01_00210414 predicted 472
7 SASI_Hs01_00210415 predicted 277
8 SASI_Hs01_00210416 predicted 235
9 SASI_Hs02_00358149 predicted 618
10 SASI_Hs02_00358150 predicted 603
11 SASI_Hs01_00210417 predicted 414
12 SASI_Hs01_00210418 predicted 402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030586 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085212 predicted 316
2 SASI_Rn01_00085213 predicted 291
3 SASI_Rn01_00085214 predicted 556
4 SASI_Rn01_00085215 predicted 588
5 SASI_Rn01_00085216 predicted 438
6 SASI_Rn01_00085217 predicted 462
7 SASI_Rn01_00085218 predicted 557
8 SASI_Rn01_00085221 predicted 572
9 SASI_Rn02_00264029 predicted 523
10 SASI_Rn02_00264030 predicted 582
11 SASI_Rn01_00085219 predicted 221
12 SASI_Rn01_00085220 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025558 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092630 predicted 553
2 SASI_Mm01_00092631 predicted 339
3 SASI_Mm01_00092632 predicted 606
4 SASI_Mm01_00092633 predicted 563
5 SASI_Mm01_00092634 predicted 390
6 SASI_Mm01_00092635 predicted 603
7 SASI_Mm01_00092636 predicted 481
8 SASI_Mm01_00092637 predicted 265
9 SASI_Mm01_00092638 predicted 394
10 SASI_Mm01_00092639 predicted 306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025558
VALIDATED
CYB5B MISSION shRNA Bacterial Glycerol Stock
cytochrome b5 type B (outer mitochondrial membrane)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025558.5-435s21c1
Sequence:CCGGCGCTATTCTTATAGGTTTCTTCTCGAGAAGAAACCTATAAGAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025558.5-764s21c1
Sequence:CCGGCCAATGACTTAGAGTTCCTATCTCGAGATAGGAACTCTAAGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025558.5-369s21c1
Sequence:CCGGCAAGGATCCTTCCAAGAACAACTCGAGTTGTTCTTGGAAGGATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025558.5-256s21c1
Sequence:CCGGGATGCAACTGAAAGCTTTGAACTCGAGTTCAAAGCTTTCAGTTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025558.2-765s1c1
Sequence:CCGGCCAATGACTTAGAGTTCCTATCTCGAGATAGGAACTCTAAGTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025558.2-370s1c1
Sequence:CCGGCAAGGATCCTTCCAAGAACAACTCGAGTTGTTCTTGGAAGGATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025558.2-2183s1c1
Sequence:CCGGCCTGTGATTTAGCAGTTGAATCTCGAGATTCAACTGCTAAATCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025558.2-257s1c1
Sequence:CCGGGATGCAACTGAAAGCTTTGAACTCGAGTTCAAAGCTTTCAGTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025558.2-436s1c1
Sequence:CCGGCGCTATTCTTATAGGTTTCTTCTCGAGAAGAAACCTATAAGAATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025558
VALIDATED
CYB5B MISSION shRNA shRNA Plasmid DNA
cytochrome b5 type B (outer mitochondrial membrane)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025558.5-435s21c1
Sequence:CCGGCGCTATTCTTATAGGTTTCTTCTCGAGAAGAAACCTATAAGAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025558.5-764s21c1
Sequence:CCGGCCAATGACTTAGAGTTCCTATCTCGAGATAGGAACTCTAAGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025558.5-369s21c1
Sequence:CCGGCAAGGATCCTTCCAAGAACAACTCGAGTTGTTCTTGGAAGGATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025558.5-256s21c1
Sequence:CCGGGATGCAACTGAAAGCTTTGAACTCGAGTTCAAAGCTTTCAGTTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025558.2-765s1c1
Sequence:CCGGCCAATGACTTAGAGTTCCTATCTCGAGATAGGAACTCTAAGTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025558.2-370s1c1
Sequence:CCGGCAAGGATCCTTCCAAGAACAACTCGAGTTGTTCTTGGAAGGATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025558.2-2183s1c1
Sequence:CCGGCCTGTGATTTAGCAGTTGAATCTCGAGATTCAACTGCTAAATCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025558.2-257s1c1
Sequence:CCGGGATGCAACTGAAAGCTTTGAACTCGAGTTCAAAGCTTTCAGTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025558.2-436s1c1
Sequence:CCGGCGCTATTCTTATAGGTTTCTTCTCGAGAAGAAACCTATAAGAATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025558
VALIDATED
CYB5B MISSION shRNA Lentiviral Transduction Particles
cytochrome b5 type B (outer mitochondrial membrane)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350319    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025558.5-435s21c1
Sequence:CCGGCGCTATTCTTATAGGTTTCTTCTCGAGAAGAAACCTATAAGAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025558.5-764s21c1
Sequence:CCGGCCAATGACTTAGAGTTCCTATCTCGAGATAGGAACTCTAAGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025558.5-369s21c1
Sequence:CCGGCAAGGATCCTTCCAAGAACAACTCGAGTTGTTCTTGGAAGGATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025558.5-256s21c1
Sequence:CCGGGATGCAACTGAAAGCTTTGAACTCGAGTTCAAAGCTTTCAGTTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025558.2-765s1c1
Sequence:CCGGCCAATGACTTAGAGTTCCTATCTCGAGATAGGAACTCTAAGTCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025558.2-370s1c1
Sequence:CCGGCAAGGATCCTTCCAAGAACAACTCGAGTTGTTCTTGGAAGGATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025558.2-2183s1c1
Sequence:CCGGCCTGTGATTTAGCAGTTGAATCTCGAGATTCAACTGCTAAATCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025558.2-257s1c1
Sequence:CCGGGATGCAACTGAAAGCTTTGAACTCGAGTTCAAAGCTTTCAGTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025558.2-436s1c1
Sequence:CCGGCGCTATTCTTATAGGTTTCTTCTCGAGAAGAAACCTATAAGAATAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030579
CYB5B MISSION shRNA Bacterial Glycerol Stock
cytochrome b5 type B (outer mitochondrial membrane)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030579.2-365s21c1
Sequence:CCGGGCAGTACTACATTGGTGATATCTCGAGATATCACCAATGTAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030579.2-149s21c1
Sequence:CCGGCGAGACCTCAGTCACCTATTACTCGAGTAATAGGTGACTGAGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030579.2-288s21c1
Sequence:CCGGCTGGAACAAGCTGGTGTAGATCTCGAGATCTACACCAGCTTGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030579.2-391s21c1
Sequence:CCGGCGAGTGACCTTAAACCTGAAACTCGAGTTTCAGGTTTAAGGTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030579.1-84s1c1
Sequence:CCGGCGAGACCTCAGTCACCTATTACTCGAGTAATAGGTGACTGAGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030579.1-300s1c1
Sequence:CCGGGCAGTACTACATTGGTGATATCTCGAGATATCACCAATGTAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030579.1-326s1c1
Sequence:CCGGCGAGTGACCTTAAACCTGAAACTCGAGTTTCAGGTTTAAGGTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030579.1-223s1c1
Sequence:CCGGCTGGAACAAGCTGGTGTAGATCTCGAGATCTACACCAGCTTGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030579.1-447s1c1
Sequence:CCGGCTACTACACATCGGAAAGCAACTCGAGTTGCTTTCCGATGTGTAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030579
CYB5B MISSION shRNA shRNA Plasmid DNA
cytochrome b5 type B (outer mitochondrial membrane)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030579.2-365s21c1
Sequence:CCGGGCAGTACTACATTGGTGATATCTCGAGATATCACCAATGTAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030579.2-149s21c1
Sequence:CCGGCGAGACCTCAGTCACCTATTACTCGAGTAATAGGTGACTGAGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030579.2-288s21c1
Sequence:CCGGCTGGAACAAGCTGGTGTAGATCTCGAGATCTACACCAGCTTGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030579.2-391s21c1
Sequence:CCGGCGAGTGACCTTAAACCTGAAACTCGAGTTTCAGGTTTAAGGTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030579.1-84s1c1
Sequence:CCGGCGAGACCTCAGTCACCTATTACTCGAGTAATAGGTGACTGAGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030579.1-300s1c1
Sequence:CCGGGCAGTACTACATTGGTGATATCTCGAGATATCACCAATGTAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030579.1-326s1c1
Sequence:CCGGCGAGTGACCTTAAACCTGAAACTCGAGTTTCAGGTTTAAGGTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030579.1-223s1c1
Sequence:CCGGCTGGAACAAGCTGGTGTAGATCTCGAGATCTACACCAGCTTGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030579.1-447s1c1
Sequence:CCGGCTACTACACATCGGAAAGCAACTCGAGTTGCTTTCCGATGTGTAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030579
CYB5B MISSION shRNA Lentiviral Transduction Particles
cytochrome b5 type B (outer mitochondrial membrane)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030579.2-365s21c1
Sequence:CCGGGCAGTACTACATTGGTGATATCTCGAGATATCACCAATGTAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030579.2-149s21c1
Sequence:CCGGCGAGACCTCAGTCACCTATTACTCGAGTAATAGGTGACTGAGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030579.2-288s21c1
Sequence:CCGGCTGGAACAAGCTGGTGTAGATCTCGAGATCTACACCAGCTTGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030579.2-391s21c1
Sequence:CCGGCGAGTGACCTTAAACCTGAAACTCGAGTTTCAGGTTTAAGGTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030579.1-84s1c1
Sequence:CCGGCGAGACCTCAGTCACCTATTACTCGAGTAATAGGTGACTGAGGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030579.1-300s1c1
Sequence:CCGGGCAGTACTACATTGGTGATATCTCGAGATATCACCAATGTAGTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030579.1-326s1c1
Sequence:CCGGCGAGTGACCTTAAACCTGAAACTCGAGTTTCAGGTTTAAGGTCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030579.1-223s1c1
Sequence:CCGGCTGGAACAAGCTGGTGTAGATCTCGAGATCTACACCAGCTTGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030579.1-447s1c1
Sequence:CCGGCTACTACACATCGGAAAGCAACTCGAGTTGCTTTCCGATGTGTAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks