EMAIL THIS PAGE TO A FRIEND

CYB5D1

cytochrome b5 domain containing 1

41 Gene Product Result for
UniProtKB ID: Q6P9G0, D3DTQ8, Q96DM7
Gene ID:
Mouse(327951) cytochrome b5 domain containing 1
Rat(363629) cytochrome b5 domain containing 1
Zebrafish(795592) cytochrome b5 domain containing 1
cow(507171) cytochrome b5 domain containing 1
dog(607970) cytochrome b5 domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144607 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001045525 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001045525 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001045525 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144607 Rosetta Predictions human pricing
NM_001045525 Rosetta Predictions mouse pricing
XM_282990 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126504 predicted 853
2 SASI_Hs01_00126505 predicted 1107
3 SASI_Hs01_00126506 predicted 1311
4 SASI_Hs01_00126507 predicted 1228
5 SASI_Hs01_00126509 predicted 1030
6 SASI_Hs01_00126510 predicted 580
7 SASI_Hs01_00126511 predicted 1297
8 SASI_Hs01_00126512 predicted 1095
9 SASI_Hs02_00364412 predicted 555
10 SASI_Hs01_00126513 predicted 684
11 SASI_Hs01_00126508 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045525 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291604 predicted 376
2 SASI_Mm02_00291605 predicted 253
3 SASI_Mm02_00291606 predicted 208
4 SASI_Mm02_00291607 predicted 460
5 SASI_Mm02_00291608 predicted 314
6 SASI_Mm02_00291609 predicted 289
7 SASI_Mm02_00291610 predicted 252
8 SASI_Mm02_00291611 predicted 380
9 SASI_Mm02_00291612 predicted 266
10 SASI_Mm02_00291613 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_282990 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271186 predicted 316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144607
VALIDATED
CYB5D1 MISSION shRNA Bacterial Glycerol Stock
cytochrome b5 domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_144607.2-234s1c1
Sequence:CCGGCGAAGACCTCTGGGTATCTTACTCGAGTAAGATACCCAGAGGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_144607.2-671s1c1
Sequence:CCGGCGTGGAAATATGAAGGGAAGACTCGAGTCTTCCCTTCATATTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_144607.2-736s1c1
Sequence:CCGGGAGGAGGAAGAATTTGACTATCTCGAGATAGTCAAATTCTTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144607.2-2678s1c1
Sequence:CCGGGCTCAATTAAACCCTGAACTACTCGAGTAGTTCAGGGTTTAATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144607.2-780s1c1
Sequence:CCGGCACACCTGCAATACTTCTGTACTCGAGTACAGAAGTATTGCAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_144607.2-804s1c1
Sequence:CCGGCAATGATGATCTCACGGAGTTCTCGAGAACTCCGTGAGATCATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144607.2-376s1c1
Sequence:CCGGGACATCCGCAAGCACATAGATCTCGAGATCTATGTGCTTGCGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144607.4-794s21c1
Sequence:CCGGCCGGAGCATCCGCATCATTAACTCGAGTTAATGATGCGGATGCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144607.4-513s21c1
Sequence:CCGGGTGTACGACCTAACGTCATTGCTCGAGCAATGACGTTAGGTCGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144607.4-1095s21c1
Sequence:CCGGGTGTAGACTCAAGACGTATTTCTCGAGAAATACGTCTTGAGTCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144607
VALIDATED
CYB5D1 MISSION shRNA shRNA Plasmid DNA
cytochrome b5 domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_144607.2-234s1c1
Sequence:CCGGCGAAGACCTCTGGGTATCTTACTCGAGTAAGATACCCAGAGGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_144607.2-671s1c1
Sequence:CCGGCGTGGAAATATGAAGGGAAGACTCGAGTCTTCCCTTCATATTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_144607.2-736s1c1
Sequence:CCGGGAGGAGGAAGAATTTGACTATCTCGAGATAGTCAAATTCTTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144607.2-2678s1c1
Sequence:CCGGGCTCAATTAAACCCTGAACTACTCGAGTAGTTCAGGGTTTAATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144607.2-780s1c1
Sequence:CCGGCACACCTGCAATACTTCTGTACTCGAGTACAGAAGTATTGCAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_144607.2-804s1c1
Sequence:CCGGCAATGATGATCTCACGGAGTTCTCGAGAACTCCGTGAGATCATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144607.2-376s1c1
Sequence:CCGGGACATCCGCAAGCACATAGATCTCGAGATCTATGTGCTTGCGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144607.4-794s21c1
Sequence:CCGGCCGGAGCATCCGCATCATTAACTCGAGTTAATGATGCGGATGCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144607.4-513s21c1
Sequence:CCGGGTGTACGACCTAACGTCATTGCTCGAGCAATGACGTTAGGTCGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144607.4-1095s21c1
Sequence:CCGGGTGTAGACTCAAGACGTATTTCTCGAGAAATACGTCTTGAGTCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144607
VALIDATED
CYB5D1 MISSION shRNA Lentiviral Transduction Particles
cytochrome b5 domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_144607.2-234s1c1
Sequence:CCGGCGAAGACCTCTGGGTATCTTACTCGAGTAAGATACCCAGAGGTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_144607.2-671s1c1
Sequence:CCGGCGTGGAAATATGAAGGGAAGACTCGAGTCTTCCCTTCATATTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_144607.2-736s1c1
Sequence:CCGGGAGGAGGAAGAATTTGACTATCTCGAGATAGTCAAATTCTTCCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144607.2-2678s1c1
Sequence:CCGGGCTCAATTAAACCCTGAACTACTCGAGTAGTTCAGGGTTTAATTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153480    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144607.2-780s1c1
Sequence:CCGGCACACCTGCAATACTTCTGTACTCGAGTACAGAAGTATTGCAGGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_144607.2-804s1c1
Sequence:CCGGCAATGATGATCTCACGGAGTTCTCGAGAACTCCGTGAGATCATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144607.2-376s1c1
Sequence:CCGGGACATCCGCAAGCACATAGATCTCGAGATCTATGTGCTTGCGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144607.4-794s21c1
Sequence:CCGGCCGGAGCATCCGCATCATTAACTCGAGTTAATGATGCGGATGCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144607.4-513s21c1
Sequence:CCGGGTGTACGACCTAACGTCATTGCTCGAGCAATGACGTTAGGTCGTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412317    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144607.4-1095s21c1
Sequence:CCGGGTGTAGACTCAAGACGTATTTCTCGAGAAATACGTCTTGAGTCTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001045525
VALIDATED
CYB5D1 MISSION shRNA Bacterial Glycerol Stock
cytochrome b5 domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045525.1-286s21c1
Sequence:CCGGGAGACATTCGCAAGCATATAGCTCGAGCTATATGCTTGCGAATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045525.1-456s21c1
Sequence:CCGGACCCGGAACATCCGTATTATTCTCGAGAATAATACGGATGTTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045525.1-147s21c1
Sequence:CCGGGAGGACCTATGGGTGTCTTACCTCGAGGTAAGACACCCATAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045525.1-170s21c1
Sequence:CCGGGGGATTTGTTTACAATCTAACCTCGAGGTTAGATTGTAAACAAATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045525.1-380s21c1
Sequence:CCGGTTCAGATTGGGCCAATGATTTCTCGAGAAATCATTGGCCCAATCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001045525
VALIDATED
CYB5D1 MISSION shRNA shRNA Plasmid DNA
cytochrome b5 domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045525.1-286s21c1
Sequence:CCGGGAGACATTCGCAAGCATATAGCTCGAGCTATATGCTTGCGAATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045525.1-456s21c1
Sequence:CCGGACCCGGAACATCCGTATTATTCTCGAGAATAATACGGATGTTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045525.1-147s21c1
Sequence:CCGGGAGGACCTATGGGTGTCTTACCTCGAGGTAAGACACCCATAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045525.1-170s21c1
Sequence:CCGGGGGATTTGTTTACAATCTAACCTCGAGGTTAGATTGTAAACAAATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045525.1-380s21c1
Sequence:CCGGTTCAGATTGGGCCAATGATTTCTCGAGAAATCATTGGCCCAATCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001045525
VALIDATED
CYB5D1 MISSION shRNA Lentiviral Transduction Particles
cytochrome b5 domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045525.1-286s21c1
Sequence:CCGGGAGACATTCGCAAGCATATAGCTCGAGCTATATGCTTGCGAATGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045525.1-456s21c1
Sequence:CCGGACCCGGAACATCCGTATTATTCTCGAGAATAATACGGATGTTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045525.1-147s21c1
Sequence:CCGGGAGGACCTATGGGTGTCTTACCTCGAGGTAAGACACCCATAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045525.1-170s21c1
Sequence:CCGGGGGATTTGTTTACAATCTAACCTCGAGGTTAGATTGTAAACAAATCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045525.1-380s21c1
Sequence:CCGGTTCAGATTGGGCCAATGATTTCTCGAGAAATCATTGGCCCAATCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks