EMAIL THIS PAGE TO A FRIEND

CYB5D2

cytochrome b5 domain containing 2

72 Gene Product Result for
UniProtKB ID: Q8WUJ1, B2R7R6, D3DTJ9, I3L1K2
Gene ID:
Mouse(192986) cytochrome b5 domain containing 2
Rat(303293) cytochrome b5 domain containing 2
Zebrafish(795950) cytochrome b5 domain containing 2
chicken(417495) cytochrome b5 domain containing 2
cow(515356) cytochrome b5 domain containing 2
dog(489437) cytochrome b5 domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100518 Anti-CYB5D2 antibody produced in rabbit affinity isolated antibody canine, human, rabbit, mouse, rat, bovine, guinea pig, horse
western blot pricing
HPA042299 Anti-CYB5D2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024926 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024926 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024926 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_109819 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_109819 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_109819 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144611 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144611 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144611 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144611 Rosetta Predictions human pricing
NR_023346 Rosetta Predictions human pricing
NR_023347 Rosetta Predictions human pricing
NM_001007671 Rosetta Predictions rat pricing
NM_001024926 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144611 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071623 predicted 1762
2 SASI_Hs01_00071624 predicted 1680
3 SASI_Hs01_00071625 predicted 931
4 SASI_Hs02_00364423 predicted 1597
5 SASI_Hs01_00071626 predicted 1086
6 SASI_Hs01_00071627 predicted 1721
7 SASI_Hs01_00071628 predicted 1200
8 SASI_Hs01_00071629 predicted 1642
9 SASI_Hs01_00071631 predicted 912
10 SASI_Hs02_00364424 predicted 1475
11 SASI_Hs01_00071630 predicted 1385
12 SASI_Hs01_00071632 predicted 1237
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023346 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381712 predicted 1491
2 SASI_Hs02_00381713 predicted 1361
3 SASI_Hs02_00381714 predicted 848
4 SASI_Hs02_00381715 predicted 1482
5 SASI_Hs02_00381716 predicted 1393
6 SASI_Hs02_00381717 predicted 1069
7 SASI_Hs02_00381718 predicted 1140
8 SASI_Hs02_00381719 predicted 1494
9 SASI_Hs02_00381720 predicted 1331
10 SASI_Hs02_00381721 predicted 957
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023347 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381722 predicted 1042
2 SASI_Hs02_00381723 predicted 908
3 SASI_Hs02_00381724 predicted 400
4 SASI_Hs02_00381725 predicted 1029
5 SASI_Hs02_00381726 predicted 947
6 SASI_Hs02_00381727 predicted 617
7 SASI_Hs02_00381728 predicted 693
8 SASI_Hs02_00381729 predicted 1035
9 SASI_Hs02_00381730 predicted 889
10 SASI_Hs02_00381731 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007671 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035099 predicted 1021
2 SASI_Rn01_00035100 predicted 535
3 SASI_Rn01_00035102 predicted 1107
4 SASI_Rn01_00035103 predicted 1226
5 SASI_Rn01_00035104 predicted 466
6 SASI_Rn02_00198801 predicted 1129
7 SASI_Rn01_00035105 predicted 653
8 SASI_Rn01_00035106 predicted 596
9 SASI_Rn02_00198802 predicted 990
10 SASI_Rn01_00035107 predicted 594
11 SASI_Rn01_00035101 predicted 976
12 SASI_Rn01_00035108 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024926 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151762 predicted 1127
2 SASI_Mm01_00151763 predicted 1042
3 SASI_Mm01_00151764 predicted 1026
4 SASI_Mm02_00287742 predicted 1025
5 SASI_Mm01_00151765 predicted 847
6 SASI_Mm01_00151767 predicted 984
7 SASI_Mm02_00287743 predicted 402
8 SASI_Mm02_00287744 predicted 370
9 SASI_Mm01_00151769 predicted 1131
10 SASI_Mm02_00287745 predicted 345
11 SASI_Mm01_00151761 predicted 1056
12 SASI_Mm01_00151766 predicted 1050
13 SASI_Mm01_00151768 predicted 1032
14 SASI_Mm01_00151770 predicted 578
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024926
CYB5D2 MISSION shRNA Bacterial Glycerol Stock
cytochrome b5 domain containing 2
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000215878    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024926.3-1534s1c1
Sequence:CCGGCAGCTTTCTTTACTCATATTGCTCGAGCAATATGAGTAAAGAAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215619    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024926.3-1346s1c1
Sequence:CCGGGGTAATTGACTGAGCTCTTAACTCGAGTTAAGAGCTCAGTCAATTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024926
CYB5D2 MISSION shRNA shRNA Plasmid DNA
cytochrome b5 domain containing 2
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000215878    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024926.3-1534s1c1
Sequence:CCGGCAGCTTTCTTTACTCATATTGCTCGAGCAATATGAGTAAAGAAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215619    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024926.3-1346s1c1
Sequence:CCGGGGTAATTGACTGAGCTCTTAACTCGAGTTAAGAGCTCAGTCAATTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024926
CYB5D2 MISSION shRNA Lentiviral Transduction Particles
cytochrome b5 domain containing 2
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000215878    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024926.3-1534s1c1
Sequence:CCGGCAGCTTTCTTTACTCATATTGCTCGAGCAATATGAGTAAAGAAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215619    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024926.3-1346s1c1
Sequence:CCGGGGTAATTGACTGAGCTCTTAACTCGAGTTAAGAGCTCAGTCAATTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_109819
CYB5D2 MISSION shRNA Bacterial Glycerol Stock
cytochrome b5 domain containing 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_109819.3-358s1c1
Sequence:CCGGGCCGGTCTTGTGGATGATATACTCGAGTATATCATCCACAAGACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_109819.3-673s1c1
Sequence:CCGGCCCAGGAAGTTGTATAAGCCACTCGAGTGGCTTATACAACTTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_109819.3-337s1c1
Sequence:CCGGGTGACAGGAGACTATTCTGAACTCGAGTTCAGAATAGTCTCCTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_109819.3-242s1c1
Sequence:CCGGGCTTCGCAGAAAGCAATACTTCTCGAGAAGTATTGCTTTCTGCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109819.3-514s1c1
Sequence:CCGGGTAGAAGCCATGGTGACTAAACTCGAGTTTAGTCACCATGGCTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109819.3-331s1c1
Sequence:CCGGGCATTTGTGACAGGAGACTATCTCGAGATAGTCTCCTGTCACAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109819.3-541s1c1
Sequence:CCGGGAGGCAAATGAACAGGAACAACTCGAGTTGTTCCTGTTCATTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109819.3-484s1c1
Sequence:CCGGGATGGGTTACCCACTTCAGAACTCGAGTTCTGAAGTGGGTAACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109819.3-408s1c1
Sequence:CCGGGCTGCACAACTGGCTTTCATTCTCGAGAATGAAAGCCAGTTGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_109819.3-246s1c1
Sequence:CCGGCGCAGAAAGCAATACTTGGTACTCGAGTACCAAGTATTGCTTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_109819
CYB5D2 MISSION shRNA shRNA Plasmid DNA
cytochrome b5 domain containing 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_109819.3-358s1c1
Sequence:CCGGGCCGGTCTTGTGGATGATATACTCGAGTATATCATCCACAAGACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_109819.3-673s1c1
Sequence:CCGGCCCAGGAAGTTGTATAAGCCACTCGAGTGGCTTATACAACTTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_109819.3-337s1c1
Sequence:CCGGGTGACAGGAGACTATTCTGAACTCGAGTTCAGAATAGTCTCCTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_109819.3-242s1c1
Sequence:CCGGGCTTCGCAGAAAGCAATACTTCTCGAGAAGTATTGCTTTCTGCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109819.3-514s1c1
Sequence:CCGGGTAGAAGCCATGGTGACTAAACTCGAGTTTAGTCACCATGGCTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109819.3-331s1c1
Sequence:CCGGGCATTTGTGACAGGAGACTATCTCGAGATAGTCTCCTGTCACAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109819.3-541s1c1
Sequence:CCGGGAGGCAAATGAACAGGAACAACTCGAGTTGTTCCTGTTCATTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109819.3-484s1c1
Sequence:CCGGGATGGGTTACCCACTTCAGAACTCGAGTTCTGAAGTGGGTAACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109819.3-408s1c1
Sequence:CCGGGCTGCACAACTGGCTTTCATTCTCGAGAATGAAAGCCAGTTGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_109819.3-246s1c1
Sequence:CCGGCGCAGAAAGCAATACTTGGTACTCGAGTACCAAGTATTGCTTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_109819
CYB5D2 MISSION shRNA Lentiviral Transduction Particles
cytochrome b5 domain containing 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_109819.3-358s1c1
Sequence:CCGGGCCGGTCTTGTGGATGATATACTCGAGTATATCATCCACAAGACCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_109819.3-673s1c1
Sequence:CCGGCCCAGGAAGTTGTATAAGCCACTCGAGTGGCTTATACAACTTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204083    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_109819.3-337s1c1
Sequence:CCGGGTGACAGGAGACTATTCTGAACTCGAGTTCAGAATAGTCTCCTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187491    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_109819.3-242s1c1
Sequence:CCGGGCTTCGCAGAAAGCAATACTTCTCGAGAAGTATTGCTTTCTGCGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109819.3-514s1c1
Sequence:CCGGGTAGAAGCCATGGTGACTAAACTCGAGTTTAGTCACCATGGCTTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109819.3-331s1c1
Sequence:CCGGGCATTTGTGACAGGAGACTATCTCGAGATAGTCTCCTGTCACAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109819.3-541s1c1
Sequence:CCGGGAGGCAAATGAACAGGAACAACTCGAGTTGTTCCTGTTCATTTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109819.3-484s1c1
Sequence:CCGGGATGGGTTACCCACTTCAGAACTCGAGTTCTGAAGTGGGTAACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_109819.3-408s1c1
Sequence:CCGGGCTGCACAACTGGCTTTCATTCTCGAGAATGAAAGCCAGTTGTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_109819.3-246s1c1
Sequence:CCGGCGCAGAAAGCAATACTTGGTACTCGAGTACCAAGTATTGCTTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144611
VALIDATED
CYB5D2 MISSION shRNA Bacterial Glycerol Stock
cytochrome b5 domain containing 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144611.2-974s1c1
Sequence:CCGGCTTGGAGGCCAACAAACTACACTCGAGTGTAGTTTGTTGGCCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_144611.2-844s1c1
Sequence:CCGGCACTTCACAATTGGCTTTCATCTCGAGATGAAAGCCAATTGTGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144611.2-1643s1c1
Sequence:CCGGCCAATACAGTACGAGGCAATACTCGAGTATTGCCTCGTACTGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_144611.2-840s1c1
Sequence:CCGGCTGACACTTCACAATTGGCTTCTCGAGAAGCCAATTGTGAAGTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144611.2-834s1c1
Sequence:CCGGGAGATGCTGACACTTCACAATCTCGAGATTGTGAAGTGTCAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144611.2-1194s1c1
Sequence:CCGGGACAACCCTCCACACAGAAATCTCGAGATTTCTGTGTGGAGGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156687    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144611.2-1642s1c1
Sequence:CCGGGCCAATACAGTACGAGGCAATCTCGAGATTGCCTCGTACTGTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144611.2-1118s1c1
Sequence:CCGGGCTGTATAAGCCAGGTGCTAACTCGAGTTAGCACCTGGCTTATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144611.2-981s1c1
Sequence:CCGGGCCAACAAACTACAGCTGCAACTCGAGTTGCAGCTGTAGTTTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144611
VALIDATED
CYB5D2 MISSION shRNA shRNA Plasmid DNA
cytochrome b5 domain containing 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144611.2-974s1c1
Sequence:CCGGCTTGGAGGCCAACAAACTACACTCGAGTGTAGTTTGTTGGCCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_144611.2-844s1c1
Sequence:CCGGCACTTCACAATTGGCTTTCATCTCGAGATGAAAGCCAATTGTGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144611.2-1643s1c1
Sequence:CCGGCCAATACAGTACGAGGCAATACTCGAGTATTGCCTCGTACTGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_144611.2-840s1c1
Sequence:CCGGCTGACACTTCACAATTGGCTTCTCGAGAAGCCAATTGTGAAGTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144611.2-834s1c1
Sequence:CCGGGAGATGCTGACACTTCACAATCTCGAGATTGTGAAGTGTCAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144611.2-1194s1c1
Sequence:CCGGGACAACCCTCCACACAGAAATCTCGAGATTTCTGTGTGGAGGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156687    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144611.2-1642s1c1
Sequence:CCGGGCCAATACAGTACGAGGCAATCTCGAGATTGCCTCGTACTGTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144611.2-1118s1c1
Sequence:CCGGGCTGTATAAGCCAGGTGCTAACTCGAGTTAGCACCTGGCTTATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144611.2-981s1c1
Sequence:CCGGGCCAACAAACTACAGCTGCAACTCGAGTTGCAGCTGTAGTTTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144611
VALIDATED
CYB5D2 MISSION shRNA Lentiviral Transduction Particles
cytochrome b5 domain containing 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144611.2-974s1c1
Sequence:CCGGCTTGGAGGCCAACAAACTACACTCGAGTGTAGTTTGTTGGCCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_144611.2-844s1c1
Sequence:CCGGCACTTCACAATTGGCTTTCATCTCGAGATGAAAGCCAATTGTGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144611.2-1643s1c1
Sequence:CCGGCCAATACAGTACGAGGCAATACTCGAGTATTGCCTCGTACTGTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_144611.2-840s1c1
Sequence:CCGGCTGACACTTCACAATTGGCTTCTCGAGAAGCCAATTGTGAAGTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153364    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144611.2-834s1c1
Sequence:CCGGGAGATGCTGACACTTCACAATCTCGAGATTGTGAAGTGTCAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144611.2-1194s1c1
Sequence:CCGGGACAACCCTCCACACAGAAATCTCGAGATTTCTGTGTGGAGGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156687    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144611.2-1642s1c1
Sequence:CCGGGCCAATACAGTACGAGGCAATCTCGAGATTGCCTCGTACTGTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_144611.2-1118s1c1
Sequence:CCGGGCTGTATAAGCCAGGTGCTAACTCGAGTTAGCACCTGGCTTATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144611.2-981s1c1
Sequence:CCGGGCCAACAAACTACAGCTGCAACTCGAGTTGCAGCTGTAGTTTGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks