EMAIL THIS PAGE TO A FRIEND

CYB5R2

cytochrome b5 reductase 2

Synonyms: B5R.2
UniProtKB ID: Q6BCY4, Q9BVA3, Q9UF68, Q9UHJ0
Gene ID:
Mouse(320635) cytochrome b5 reductase 2
Rat(365345) cytochrome b5 reductase 2
Zebrafish(751641) cytochrome b5 reductase 2
cow(536960) cytochrome b5 reductase 2
dog(485367) cytochrome b5 reductase 2
chicken(408182) cytochrome b5 reductase 2
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016229 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016229 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016229 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177216 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177216 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177216 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146011 MISSION® esiRNA esiRNA human CYB5R2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016229 Rosetta Predictions human pricing
NM_001014244 Rosetta Predictions rat pricing
NM_177216 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016229 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077868 predicted 377
2 SASI_Hs01_00077869 predicted 678
3 SASI_Hs01_00077870 predicted 543
4 SASI_Hs01_00077871 predicted 282
5 SASI_Hs01_00077872 predicted 851
6 SASI_Hs01_00077873 predicted 389
7 SASI_Hs01_00077874 predicted 645
8 SASI_Hs01_00077875 predicted 1018
9 SASI_Hs01_00077876 predicted 1032
10 SASI_Hs01_00077877 predicted 917
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014244 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057475 predicted 388
2 SASI_Rn01_00057476 predicted 973
3 SASI_Rn01_00057477 predicted 903
4 SASI_Rn01_00057478 predicted 396
5 SASI_Rn01_00057479 predicted 804
6 SASI_Rn01_00057480 predicted 359
7 SASI_Rn01_00057481 predicted 316
8 SASI_Rn01_00057482 predicted 247
9 SASI_Rn01_00057483 predicted 1038
10 SASI_Rn02_00201808 predicted 846
11 SASI_Rn01_00057474 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177216 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190445 predicted 969
2 SASI_Mm01_00190446 predicted 234
3 SASI_Mm01_00190447 predicted 554
4 SASI_Mm01_00190448 predicted 886
5 SASI_Mm01_00190449 predicted 316
6 SASI_Mm01_00190450 predicted 697
7 SASI_Mm01_00190451 predicted 318
8 SASI_Mm01_00190452 predicted 879
9 SASI_Mm01_00190453 predicted 257
10 SASI_Mm02_00347240 predicted 463
11 SASI_Mm01_00190444 predicted 387
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016229
VALIDATED
CYB5R2 MISSION shRNA Bacterial Glycerol Stock
cytochrome b5 reductase 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016229.3-726s21c1
Sequence:CCGGTGCAGCTCATTCGCCACATCACTCGAGTGATGTGGCGAATGAGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016229.3-1072s21c1
Sequence:CCGGCCTCCACGTGCTCAGCAATTTCTCGAGAAATTGCTGAGCACGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016229.3-904s21c1
Sequence:CCGGGTACAGCTCAGGCTTCGTTACCTCGAGGTAACGAAGCCTGAGCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016229.3-647s21c1
Sequence:CCGGGACCAGACGAGTGAGCCTAAACTCGAGTTTAGGCTCACTCGTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016229.3-1038s21c1
Sequence:CCGGGTTATACCCAGGACATGATTTCTCGAGAAATCATGTCCTGGGTATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016229.3-1125s21c1
Sequence:CCGGTTCAATTTCACCACGGTAAACCTCGAGGTTTACCGTGGTGAAATTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016229.1-204s1c1
Sequence:CCGGCCGCTGCCATTGATTGAGAAACTCGAGTTTCTCAATCAATGGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016229.1-840s1c1
Sequence:CCGGGACATGATCAAGGAGCACCTTCTCGAGAAGGTGCTCCTTGATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016229.1-534s1c1
Sequence:CCGGCCACGGAATCTTGGAATCAGACTCGAGTCTGATTCCAAGATTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016229.1-380s1c1
Sequence:CCGGCAGAGGCTTTGTGGACCTAATCTCGAGATTAGGTCCACAAAGCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016229.1-273s1c1
Sequence:CCGGCCGGACCATGTCTTAGGGCTTCTCGAGAAGCCCTAAGACATGGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016229
VALIDATED
CYB5R2 MISSION shRNA shRNA Plasmid DNA
cytochrome b5 reductase 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016229.3-726s21c1
Sequence:CCGGTGCAGCTCATTCGCCACATCACTCGAGTGATGTGGCGAATGAGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016229.3-1072s21c1
Sequence:CCGGCCTCCACGTGCTCAGCAATTTCTCGAGAAATTGCTGAGCACGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016229.3-904s21c1
Sequence:CCGGGTACAGCTCAGGCTTCGTTACCTCGAGGTAACGAAGCCTGAGCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016229.3-647s21c1
Sequence:CCGGGACCAGACGAGTGAGCCTAAACTCGAGTTTAGGCTCACTCGTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016229.3-1038s21c1
Sequence:CCGGGTTATACCCAGGACATGATTTCTCGAGAAATCATGTCCTGGGTATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016229.3-1125s21c1
Sequence:CCGGTTCAATTTCACCACGGTAAACCTCGAGGTTTACCGTGGTGAAATTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016229.1-204s1c1
Sequence:CCGGCCGCTGCCATTGATTGAGAAACTCGAGTTTCTCAATCAATGGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016229.1-840s1c1
Sequence:CCGGGACATGATCAAGGAGCACCTTCTCGAGAAGGTGCTCCTTGATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016229.1-534s1c1
Sequence:CCGGCCACGGAATCTTGGAATCAGACTCGAGTCTGATTCCAAGATTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016229.1-380s1c1
Sequence:CCGGCAGAGGCTTTGTGGACCTAATCTCGAGATTAGGTCCACAAAGCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016229.1-273s1c1
Sequence:CCGGCCGGACCATGTCTTAGGGCTTCTCGAGAAGCCCTAAGACATGGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016229
VALIDATED
CYB5R2 MISSION shRNA Lentiviral Transduction Particles
cytochrome b5 reductase 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016229.3-726s21c1
Sequence:CCGGTGCAGCTCATTCGCCACATCACTCGAGTGATGTGGCGAATGAGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434466    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016229.3-1072s21c1
Sequence:CCGGCCTCCACGTGCTCAGCAATTTCTCGAGAAATTGCTGAGCACGTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016229.3-904s21c1
Sequence:CCGGGTACAGCTCAGGCTTCGTTACCTCGAGGTAACGAAGCCTGAGCTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016229.3-647s21c1
Sequence:CCGGGACCAGACGAGTGAGCCTAAACTCGAGTTTAGGCTCACTCGTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016229.3-1038s21c1
Sequence:CCGGGTTATACCCAGGACATGATTTCTCGAGAAATCATGTCCTGGGTATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016229.3-1125s21c1
Sequence:CCGGTTCAATTTCACCACGGTAAACCTCGAGGTTTACCGTGGTGAAATTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016229.1-204s1c1
Sequence:CCGGCCGCTGCCATTGATTGAGAAACTCGAGTTTCTCAATCAATGGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016229.1-840s1c1
Sequence:CCGGGACATGATCAAGGAGCACCTTCTCGAGAAGGTGCTCCTTGATCATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016229.1-534s1c1
Sequence:CCGGCCACGGAATCTTGGAATCAGACTCGAGTCTGATTCCAAGATTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016229.1-380s1c1
Sequence:CCGGCAGAGGCTTTGTGGACCTAATCTCGAGATTAGGTCCACAAAGCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016229.1-273s1c1
Sequence:CCGGCCGGACCATGTCTTAGGGCTTCTCGAGAAGCCCTAAGACATGGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177216
CYB5R2 MISSION shRNA Bacterial Glycerol Stock
cytochrome b5 reductase 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177216.3-151s1c1
Sequence:CCGGCTTGATTGAGAAGGAGCAAATCTCGAGATTTGCTCCTTCTCAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177216.3-643s1c1
Sequence:CCGGCCAGACAGAAGAGGATATCTTCTCGAGAAGATATCCTCTTCTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177216.3-320s21c1
Sequence:CCGGCAAGGCTTTGTGGACTTAATTCTCGAGAATTAAGTCCACAAAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177216.3-228s21c1
Sequence:CCGGGGCTTCCTGTCGGTAACTATGCTCGAGCATAGTTACCGACAGGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177216.3-1140s21c1
Sequence:CCGGTCCATGGCTTAGCGGAATAAACTCGAGTTTATTCCGCTAAGCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177216.3-250s21c1
Sequence:CCGGCCATCTCTTGGCACAAATTAACTCGAGTTAATTTGTGCCAAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177216.3-888s21c1
Sequence:CCGGGCTATACCAAGGACATGATTTCTCGAGAAATCATGTCCTTGGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177216.2-884s1c1
Sequence:CCGGGCTCAGCTATACCAAGGACATCTCGAGATGTCCTTGGTATAGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177216
CYB5R2 MISSION shRNA shRNA Plasmid DNA
cytochrome b5 reductase 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177216.3-151s1c1
Sequence:CCGGCTTGATTGAGAAGGAGCAAATCTCGAGATTTGCTCCTTCTCAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177216.3-643s1c1
Sequence:CCGGCCAGACAGAAGAGGATATCTTCTCGAGAAGATATCCTCTTCTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177216.3-320s21c1
Sequence:CCGGCAAGGCTTTGTGGACTTAATTCTCGAGAATTAAGTCCACAAAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177216.3-228s21c1
Sequence:CCGGGGCTTCCTGTCGGTAACTATGCTCGAGCATAGTTACCGACAGGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177216.3-1140s21c1
Sequence:CCGGTCCATGGCTTAGCGGAATAAACTCGAGTTTATTCCGCTAAGCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177216.3-250s21c1
Sequence:CCGGCCATCTCTTGGCACAAATTAACTCGAGTTAATTTGTGCCAAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177216.3-888s21c1
Sequence:CCGGGCTATACCAAGGACATGATTTCTCGAGAAATCATGTCCTTGGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177216.2-884s1c1
Sequence:CCGGGCTCAGCTATACCAAGGACATCTCGAGATGTCCTTGGTATAGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177216
CYB5R2 MISSION shRNA Lentiviral Transduction Particles
cytochrome b5 reductase 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177216.3-151s1c1
Sequence:CCGGCTTGATTGAGAAGGAGCAAATCTCGAGATTTGCTCCTTCTCAATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177216.3-643s1c1
Sequence:CCGGCCAGACAGAAGAGGATATCTTCTCGAGAAGATATCCTCTTCTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177216.3-320s21c1
Sequence:CCGGCAAGGCTTTGTGGACTTAATTCTCGAGAATTAAGTCCACAAAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177216.3-228s21c1
Sequence:CCGGGGCTTCCTGTCGGTAACTATGCTCGAGCATAGTTACCGACAGGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249084    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177216.3-1140s21c1
Sequence:CCGGTCCATGGCTTAGCGGAATAAACTCGAGTTTATTCCGCTAAGCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177216.3-250s21c1
Sequence:CCGGCCATCTCTTGGCACAAATTAACTCGAGTTAATTTGTGCCAAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177216.3-888s21c1
Sequence:CCGGGCTATACCAAGGACATGATTTCTCGAGAAATCATGTCCTTGGTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177216.2-884s1c1
Sequence:CCGGGCTCAGCTATACCAAGGACATCTCGAGATGTCCTTGGTATAGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks