EMAIL THIS PAGE TO A FRIEND

CYB5R3

cytochrome b5 reductase 3

77 Gene Product Result for
Synonyms: B5R DIA1
Gene ID:
Human(1727) Summary: This gene encodes cytochrome b5 reductase, which includes a membrane-bound form in somatic cells (anchored in the endoplasmic reticulum, mitochondrial and other membranes) and a soluble form in erythrocytes. The membrane-bound form exists mainly on the cytoplasmic side of the endoplasmic reticulum and functions in desaturation and elongation of fatty acids, in cholesterol biosynthesis, and in drug metabolism. The erythrocyte form is located in a soluble fraction of circulating erythrocytes and is involved in methemoglobin reduction. The membrane-bound form has both membrane-binding and catalytic domains, while the soluble form has only the catalytic domain. Alternate splicing results in multiple transcript variants. Mutations in this gene cause methemoglobinemias. [provided by RefSeq, Jan 2010]
Mouse(109754) cytochrome b5 reductase 3
Rat(25035) cytochrome b5 reductase 3
Zebrafish(324560) cytochrome b5 reductase 3
cow(515773) cytochrome b5 reductase 3
dog(474479) cytochrome b5 reductase 3
chicken(418220) cytochrome b5 reductase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007326 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007326 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007326 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029787 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029787 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029787 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000398 Rosetta Predictions human pricing
NM_007326 Rosetta Predictions human pricing
NM_138877 Rosetta Predictions rat pricing
NM_029787 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122538 predicted 311
2 SASI_Hs02_00302472 predicted 609
3 SASI_Hs01_00122539 predicted 1204
4 SASI_Hs01_00122540 predicted 578
5 SASI_Hs01_00122541 predicted 749
6 SASI_Hs01_00122544 predicted 812
7 SASI_Hs01_00122545 predicted 1468
8 SASI_Hs01_00122546 predicted 1194
9 SASI_Hs02_00302473 predicted 1446
10 SASI_Hs01_00122547 predicted 657
11 SASI_Hs01_00122542 predicted 651
12 SASI_Hs01_00122543 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110909 predicted 338
2 SASI_Hs02_00343402 predicted 622
3 SASI_Hs01_00110910 predicted 1231
4 SASI_Hs01_00110911 predicted 601
5 SASI_Hs01_00110912 predicted 772
6 SASI_Hs01_00110915 predicted 833
7 SASI_Hs01_00110916 predicted 1485
8 SASI_Hs01_00110917 predicted 1217
9 SASI_Hs02_00343403 predicted 1470
10 SASI_Hs01_00110918 predicted 678
11 SASI_Hs01_00110913 predicted 667
12 SASI_Hs01_00110914 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138877 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040509 predicted 347
2 SASI_Rn01_00040510 predicted 544
3 SASI_Rn01_00040511 predicted 874
4 SASI_Rn01_00040512 predicted 561
5 SASI_Rn01_00040513 predicted 722
6 SASI_Rn01_00040514 predicted 472
7 SASI_Rn01_00040515 predicted 238
8 SASI_Rn01_00040516 predicted 767
9 SASI_Rn01_00040517 predicted 920
10 SASI_Rn01_00040518 predicted 700
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029787 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00175445 predicted 316
2 SASI_Mm01_00175446 predicted 239
3 SASI_Mm01_00175447 predicted 912
4 SASI_Mm01_00175449 predicted 585
5 SASI_Mm01_00175450 predicted 760
6 SASI_Mm01_00175451 predicted 601
7 SASI_Mm01_00175452 predicted 517
8 SASI_Mm01_00175453 predicted 686
9 SASI_Mm01_00175454 predicted 959
10 SASI_Mm02_00335931 predicted 958
11 SASI_Mm01_00175448 predicted 397
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007326
VALIDATED
CYB5R3 MISSION shRNA Bacterial Glycerol Stock
cytochrome b5 reductase 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_007326.1-604s1c1
Sequence:CCGGCCCTATCATCAGGACAGTGAACTCGAGTTCACTGTCCTGATGATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_007326.1-440s1c1
Sequence:CCGGGTTTACTTCAAGGACACCCATCTCGAGATGGGTGTCCTTGAAGTAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_007326.1-349s1c1
Sequence:CCGGCTCGGCTCGAATTGATGGAAACTCGAGTTTCCATCAATTCGAGCCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_007326.1-427s1c1
Sequence:CCGGCCTGGTCATCAAGGTTTACTTCTCGAGAAGTAAACCTTGATGACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_007326.1-784s1c1
Sequence:CCGGGAACAAACATTCTGCACGCTTCTCGAGAAGCGTGCAGAATGTTTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_007326.3-748s21c1
Sequence:CCGGTGGAGGAACTCAGGAACAAACCTCGAGGTTTGTTCCTGAGTTCCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007326.3-319s21c1
Sequence:CCGGTCTACCTCTCGGCTCGAATTGCTCGAGCAATTCGAGCCGAGAGGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007326.3-472s21c1
Sequence:CCGGACCTGGAGAGCATGCAGATTGCTCGAGCAATCTGCATGCTCTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007326.3-427s21c1
Sequence:CCGGAGGACACCCATCCCAAGTTTCCTCGAGGAAACTTGGGATGGGTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236407    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007326.3-1459s21c1
Sequence:CCGGCTGACGCTGCATGAGACATTGCTCGAGCAATGTCTCATGCAGCGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007326
VALIDATED
CYB5R3 MISSION shRNA shRNA Plasmid DNA
cytochrome b5 reductase 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_007326.1-604s1c1
Sequence:CCGGCCCTATCATCAGGACAGTGAACTCGAGTTCACTGTCCTGATGATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_007326.1-440s1c1
Sequence:CCGGGTTTACTTCAAGGACACCCATCTCGAGATGGGTGTCCTTGAAGTAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_007326.1-349s1c1
Sequence:CCGGCTCGGCTCGAATTGATGGAAACTCGAGTTTCCATCAATTCGAGCCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_007326.1-427s1c1
Sequence:CCGGCCTGGTCATCAAGGTTTACTTCTCGAGAAGTAAACCTTGATGACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_007326.1-784s1c1
Sequence:CCGGGAACAAACATTCTGCACGCTTCTCGAGAAGCGTGCAGAATGTTTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_007326.3-748s21c1
Sequence:CCGGTGGAGGAACTCAGGAACAAACCTCGAGGTTTGTTCCTGAGTTCCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007326.3-319s21c1
Sequence:CCGGTCTACCTCTCGGCTCGAATTGCTCGAGCAATTCGAGCCGAGAGGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007326.3-472s21c1
Sequence:CCGGACCTGGAGAGCATGCAGATTGCTCGAGCAATCTGCATGCTCTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007326.3-427s21c1
Sequence:CCGGAGGACACCCATCCCAAGTTTCCTCGAGGAAACTTGGGATGGGTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236407    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007326.3-1459s21c1
Sequence:CCGGCTGACGCTGCATGAGACATTGCTCGAGCAATGTCTCATGCAGCGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007326
VALIDATED
CYB5R3 MISSION shRNA Lentiviral Transduction Particles
cytochrome b5 reductase 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_007326.1-604s1c1
Sequence:CCGGCCCTATCATCAGGACAGTGAACTCGAGTTCACTGTCCTGATGATAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_007326.1-440s1c1
Sequence:CCGGGTTTACTTCAAGGACACCCATCTCGAGATGGGTGTCCTTGAAGTAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_007326.1-349s1c1
Sequence:CCGGCTCGGCTCGAATTGATGGAAACTCGAGTTTCCATCAATTCGAGCCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A3
TRC Version: 1 Clone ID:NM_007326.1-427s1c1
Sequence:CCGGCCTGGTCATCAAGGTTTACTTCTCGAGAAGTAAACCTTGATGACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_007326.1-784s1c1
Sequence:CCGGGAACAAACATTCTGCACGCTTCTCGAGAAGCGTGCAGAATGTTTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_007326.3-748s21c1
Sequence:CCGGTGGAGGAACTCAGGAACAAACCTCGAGGTTTGTTCCTGAGTTCCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007326.3-319s21c1
Sequence:CCGGTCTACCTCTCGGCTCGAATTGCTCGAGCAATTCGAGCCGAGAGGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007326.3-472s21c1
Sequence:CCGGACCTGGAGAGCATGCAGATTGCTCGAGCAATCTGCATGCTCTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_007326.3-427s21c1
Sequence:CCGGAGGACACCCATCCCAAGTTTCCTCGAGGAAACTTGGGATGGGTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236407    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_007326.3-1459s21c1
Sequence:CCGGCTGACGCTGCATGAGACATTGCTCGAGCAATGTCTCATGCAGCGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029787
VALIDATED
CYB5R3 MISSION shRNA Bacterial Glycerol Stock
cytochrome b5 reductase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029787.2-1813s1c1
Sequence:CCGGCAACAGAGTTTGGTAGACCTTCTCGAGAAGGTCTACCAAACTCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029787.2-590s1c1
Sequence:CCGGGTGAAGTCTGTAGGCATGATTCTCGAGAATCATGCCTACAGACTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029787.2-743s1c1
Sequence:CCGGGAGGAACTGAGGAACGAACATCTCGAGATGTTCGTTCCTCAGTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029787.2-292s1c1
Sequence:CCGGCCTTCCTATTGGCCAACACATCTCGAGATGTGTTGGCCAATAGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029787.2-757s1c1
Sequence:CCGGCGAACATTCTGCTCGCTTCAACTCGAGTTGAAGCGAGCAGAATGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029787
VALIDATED
CYB5R3 MISSION shRNA shRNA Plasmid DNA
cytochrome b5 reductase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029787.2-1813s1c1
Sequence:CCGGCAACAGAGTTTGGTAGACCTTCTCGAGAAGGTCTACCAAACTCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029787.2-590s1c1
Sequence:CCGGGTGAAGTCTGTAGGCATGATTCTCGAGAATCATGCCTACAGACTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029787.2-743s1c1
Sequence:CCGGGAGGAACTGAGGAACGAACATCTCGAGATGTTCGTTCCTCAGTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029787.2-292s1c1
Sequence:CCGGCCTTCCTATTGGCCAACACATCTCGAGATGTGTTGGCCAATAGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029787.2-757s1c1
Sequence:CCGGCGAACATTCTGCTCGCTTCAACTCGAGTTGAAGCGAGCAGAATGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029787
VALIDATED
CYB5R3 MISSION shRNA Lentiviral Transduction Particles
cytochrome b5 reductase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126224    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029787.2-1813s1c1
Sequence:CCGGCAACAGAGTTTGGTAGACCTTCTCGAGAAGGTCTACCAAACTCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029787.2-590s1c1
Sequence:CCGGGTGAAGTCTGTAGGCATGATTCTCGAGAATCATGCCTACAGACTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029787.2-743s1c1
Sequence:CCGGGAGGAACTGAGGAACGAACATCTCGAGATGTTCGTTCCTCAGTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029787.2-292s1c1
Sequence:CCGGCCTTCCTATTGGCCAACACATCTCGAGATGTGTTGGCCAATAGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_029787.2-757s1c1
Sequence:CCGGCGAACATTCTGCTCGCTTCAACTCGAGTTGAAGCGAGCAGAATGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)