EMAIL THIS PAGE TO A FRIEND

CYB5R4

cytochrome b5 reductase 4

111 Gene Product Result for
Synonyms: NCB5OR RP4-676J13.1 cb5/cb5R dJ676J13.1
UniProtKB ID: Q7L1T6, B1AEM2, Q5TGI9, Q9NUE4, Q9UHI9
Gene ID:
Human(51167) Summary: NCB5OR is a flavohemoprotein that contains functional domains found in both cytochrome b5 (CYB5A; MIM 613218) and CYB5 reductase (CYB5R3; MIM 613213) (Zhu et al., 1999 [PubMed 10611283]
Mouse(266690) cytochrome b5 reductase 4
Rat(171015) cytochrome b5 reductase 4
Zebrafish(553685) cytochrome b5 reductase 4
dog(474982) cytochrome b5 reductase 4
cow(533608) cytochrome b5 reductase 4
chicken(421837) cytochrome b5 reductase 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024195 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024195 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024195 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016230 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016230 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016230 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016230 Rosetta Predictions human pricing
NM_133427 Rosetta Predictions rat pricing
NM_024195 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198926 predicted 1278
2 SASI_Hs01_00198927 predicted 283
3 SASI_Hs01_00198928 predicted 347
4 SASI_Hs01_00198930 predicted 374
5 SASI_Hs02_00349096 predicted 262
6 SASI_Hs01_00198931 predicted 454
7 SASI_Hs01_00198932 predicted 335
8 SASI_Hs01_00198933 predicted 1500
9 SASI_Hs02_00349097 predicted 1331
10 SASI_Hs01_00198934 predicted 1721
11 SASI_Hs01_00198929 predicted 1716
12 SASI_Hs01_00198935 predicted 1379
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133427 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267685 predicted 634
2 SASI_Rn01_00035371 predicted 328
3 SASI_Rn01_00035372 predicted 1313
4 SASI_Rn01_00035373 predicted 214
5 SASI_Rn02_00267686 predicted 1426
6 SASI_Rn01_00035375 predicted 240
7 SASI_Rn01_00035377 predicted 929
8 SASI_Rn01_00035378 predicted 270
9 SASI_Rn01_00035379 predicted 736
10 SASI_Rn01_00035380 predicted 1229
11 SASI_Rn01_00035374 predicted 636
12 SASI_Rn01_00035376 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024195 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327527 predicted 352
2 SASI_Mm01_00057825 predicted 687
3 SASI_Mm01_00057826 predicted 476
4 SASI_Mm01_00057827 predicted 1433
5 SASI_Mm02_00327528 predicted 290
6 SASI_Mm01_00057832 predicted 702
7 SASI_Mm01_00057829 predicted 984
8 SASI_Mm01_00057831 predicted 1377
9 SASI_Mm02_00327529 predicted 733
10 SASI_Mm02_00327530 predicted 1631
11 SASI_Mm01_00057824 predicted 1264
12 SASI_Mm01_00057828 predicted 880
13 SASI_Mm01_00057830 predicted 1237
14 SASI_Mm01_00057833 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024195
VALIDATED
CYB5R4 MISSION shRNA Bacterial Glycerol Stock
cytochrome b5 reductase 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024195.2-945s21c1
Sequence:CCGGCCTGGAGAAACATGATTCTTTCTCGAGAAAGAATCATGTTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024195.2-1129s21c1
Sequence:CCGGGCAGAAATAGTAAAGCCATATCTCGAGATATGGCTTTACTATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024195.2-1365s21c1
Sequence:CCGGCGGAACAGGATTCACACCAATCTCGAGATTGGTGTGAATCCTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024195.2-1585s21c1
Sequence:CCGGCGAGCTCTTCTCTCTGAATTTCTCGAGAAATTCAGAGAGAAGAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024195.1-1333s1c1
Sequence:CCGGCGAGCTCTTCTCTCTGAATTTCTCGAGAAATTCAGAGAGAAGAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024195.1-693s1c1
Sequence:CCGGCCTGGAGAAACATGATTCTTTCTCGAGAAAGAATCATGTTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024195.1-421s1c1
Sequence:CCGGCCAAGCTATGATTGGTTCCAACTCGAGTTGGAACCAATCATAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024195.1-1113s1c1
Sequence:CCGGCGGAACAGGATTCACACCAATCTCGAGATTGGTGTGAATCCTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024195.1-877s1c1
Sequence:CCGGGCAGAAATAGTAAAGCCATATCTCGAGATATGGCTTTACTATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024195
VALIDATED
CYB5R4 MISSION shRNA shRNA Plasmid DNA
cytochrome b5 reductase 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024195.2-945s21c1
Sequence:CCGGCCTGGAGAAACATGATTCTTTCTCGAGAAAGAATCATGTTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024195.2-1129s21c1
Sequence:CCGGGCAGAAATAGTAAAGCCATATCTCGAGATATGGCTTTACTATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024195.2-1365s21c1
Sequence:CCGGCGGAACAGGATTCACACCAATCTCGAGATTGGTGTGAATCCTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024195.2-1585s21c1
Sequence:CCGGCGAGCTCTTCTCTCTGAATTTCTCGAGAAATTCAGAGAGAAGAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024195.1-1333s1c1
Sequence:CCGGCGAGCTCTTCTCTCTGAATTTCTCGAGAAATTCAGAGAGAAGAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024195.1-693s1c1
Sequence:CCGGCCTGGAGAAACATGATTCTTTCTCGAGAAAGAATCATGTTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024195.1-421s1c1
Sequence:CCGGCCAAGCTATGATTGGTTCCAACTCGAGTTGGAACCAATCATAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024195.1-1113s1c1
Sequence:CCGGCGGAACAGGATTCACACCAATCTCGAGATTGGTGTGAATCCTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024195.1-877s1c1
Sequence:CCGGGCAGAAATAGTAAAGCCATATCTCGAGATATGGCTTTACTATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024195
VALIDATED
CYB5R4 MISSION shRNA Lentiviral Transduction Particles
cytochrome b5 reductase 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024195.2-945s21c1
Sequence:CCGGCCTGGAGAAACATGATTCTTTCTCGAGAAAGAATCATGTTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024195.2-1129s21c1
Sequence:CCGGGCAGAAATAGTAAAGCCATATCTCGAGATATGGCTTTACTATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024195.2-1365s21c1
Sequence:CCGGCGGAACAGGATTCACACCAATCTCGAGATTGGTGTGAATCCTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024195.2-1585s21c1
Sequence:CCGGCGAGCTCTTCTCTCTGAATTTCTCGAGAAATTCAGAGAGAAGAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024195.1-1333s1c1
Sequence:CCGGCGAGCTCTTCTCTCTGAATTTCTCGAGAAATTCAGAGAGAAGAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024195.1-693s1c1
Sequence:CCGGCCTGGAGAAACATGATTCTTTCTCGAGAAAGAATCATGTTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024195.1-421s1c1
Sequence:CCGGCCAAGCTATGATTGGTTCCAACTCGAGTTGGAACCAATCATAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024195.1-1113s1c1
Sequence:CCGGCGGAACAGGATTCACACCAATCTCGAGATTGGTGTGAATCCTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024195.1-877s1c1
Sequence:CCGGGCAGAAATAGTAAAGCCATATCTCGAGATATGGCTTTACTATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016230
VALIDATED
CYB5R4 MISSION shRNA Bacterial Glycerol Stock
cytochrome b5 reductase 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016230.3-463s21c1
Sequence:CCGGGTTCATCGTTGGGTCAATTATCTCGAGATAATTGACCCAACGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016230.3-1980s21c1
Sequence:CCGGATATCACTGTTCTACAATAAGCTCGAGCTTATTGTAGAACAGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016230.3-1065s21c1
Sequence:CCGGTTACCTCAAGCTACCTATTACCTCGAGGTAATAGGTAGCTTGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016230.3-353s21c1
Sequence:CCGGGCATAAGAGGTTTCGTTTATACTCGAGTATAAACGAAACCTCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_016230.2-397s1c1
Sequence:CCGGGCAGGATCAGATGGTACTGAACTCGAGTTCAGTACCATCTGATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_016230.2-230s1c1
Sequence:CCGGGAAAGGATCTAACGGGATTAACTCGAGTTAATCCCGTTAGATCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_016230.2-707s1c1
Sequence:CCGGCCTTTAGAGCAGAAACAATTACTCGAGTAATTGTTTCTGCTCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_016230.2-1117s1c1
Sequence:CCGGCCAGTTCTTCCCAACAATAAACTCGAGTTTATTGTTGGGAAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_016230.2-1556s1c1
Sequence:CCGGCCAAAGTTCTCGTCTGCATTTCTCGAGAAATGCAGACGAGAACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016230
VALIDATED
CYB5R4 MISSION shRNA shRNA Plasmid DNA
cytochrome b5 reductase 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016230.3-463s21c1
Sequence:CCGGGTTCATCGTTGGGTCAATTATCTCGAGATAATTGACCCAACGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016230.3-1980s21c1
Sequence:CCGGATATCACTGTTCTACAATAAGCTCGAGCTTATTGTAGAACAGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016230.3-1065s21c1
Sequence:CCGGTTACCTCAAGCTACCTATTACCTCGAGGTAATAGGTAGCTTGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016230.3-353s21c1
Sequence:CCGGGCATAAGAGGTTTCGTTTATACTCGAGTATAAACGAAACCTCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_016230.2-397s1c1
Sequence:CCGGGCAGGATCAGATGGTACTGAACTCGAGTTCAGTACCATCTGATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_016230.2-230s1c1
Sequence:CCGGGAAAGGATCTAACGGGATTAACTCGAGTTAATCCCGTTAGATCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_016230.2-707s1c1
Sequence:CCGGCCTTTAGAGCAGAAACAATTACTCGAGTAATTGTTTCTGCTCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_016230.2-1117s1c1
Sequence:CCGGCCAGTTCTTCCCAACAATAAACTCGAGTTTATTGTTGGGAAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_016230.2-1556s1c1
Sequence:CCGGCCAAAGTTCTCGTCTGCATTTCTCGAGAAATGCAGACGAGAACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016230
VALIDATED
CYB5R4 MISSION shRNA Lentiviral Transduction Particles
cytochrome b5 reductase 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016230.3-463s21c1
Sequence:CCGGGTTCATCGTTGGGTCAATTATCTCGAGATAATTGACCCAACGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016230.3-1980s21c1
Sequence:CCGGATATCACTGTTCTACAATAAGCTCGAGCTTATTGTAGAACAGTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_016230.3-1065s21c1
Sequence:CCGGTTACCTCAAGCTACCTATTACCTCGAGGTAATAGGTAGCTTGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_016230.3-353s21c1
Sequence:CCGGGCATAAGAGGTTTCGTTTATACTCGAGTATAAACGAAACCTCTTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_016230.2-397s1c1
Sequence:CCGGGCAGGATCAGATGGTACTGAACTCGAGTTCAGTACCATCTGATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_016230.2-230s1c1
Sequence:CCGGGAAAGGATCTAACGGGATTAACTCGAGTTAATCCCGTTAGATCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A3
TRC Version: 1 Clone ID:NM_016230.2-707s1c1
Sequence:CCGGCCTTTAGAGCAGAAACAATTACTCGAGTAATTGTTTCTGCTCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_016230.2-1117s1c1
Sequence:CCGGCCAGTTCTTCCCAACAATAAACTCGAGTTTATTGTTGGGAAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046439    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_016230.2-1556s1c1
Sequence:CCGGCCAAAGTTCTCGTCTGCATTTCTCGAGAAATGCAGACGAGAACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks