EMAIL THIS PAGE TO A FRIEND

CYB5RL

cytochrome b5 reductase-like

50 Gene Product Result for
UniProtKB ID: Q6IPT4, B7ZBS4, Q8NF25
Gene ID:
Mouse(230582) cytochrome b5 reductase-like
Rat(689035) cytochrome b5 reductase-like
cow(526748) cytochrome b5 reductase-like
dog(610595) cytochrome b5 reductase-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001031672 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001031672 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001031672 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175471 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175471 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175471 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031672 Rosetta Predictions human pricing
XM_001069267 Rosetta Predictions rat pricing
NM_175471 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160777 predicted 596
2 SASI_Hs02_00307667 predicted 916
3 SASI_Hs02_00307668 predicted 819
4 SASI_Hs02_00307669 predicted 1028
5 SASI_Hs02_00307670 predicted 725
6 SASI_Hs02_00307671 predicted 925
7 SASI_Hs02_00307672 predicted 823
8 SASI_Hs02_00307673 predicted 722
9 SASI_Hs02_00307674 predicted 603
10 SASI_Hs02_00307675 predicted 764
11 SASI_Hs01_00160768 predicted 484
12 SASI_Hs01_00160769 predicted 360
13 SASI_Hs01_00160770 predicted 363
14 SASI_Hs01_00160771 predicted 439
15 SASI_Hs01_00160772 predicted 431
16 SASI_Hs01_00160773 predicted 432
17 SASI_Hs01_00160774 predicted 427
18 SASI_Hs01_00160775 predicted 368
19 SASI_Hs01_00160776 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069267 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327430 predicted 710
2 SASI_Rn02_00327431 predicted 302
3 SASI_Rn02_00327432 predicted 607
4 SASI_Rn02_00327433 predicted 591
5 SASI_Rn02_00327434 predicted 855
6 SASI_Rn02_00327435 predicted 831
7 SASI_Rn02_00327436 predicted 494
8 SASI_Rn02_00327437 predicted 368
9 SASI_Rn02_00327438 predicted 282
10 SASI_Rn02_00327439 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175471 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169813 predicted 584
2 SASI_Mm01_00169814 predicted 689
3 SASI_Mm01_00169815 predicted 848
4 SASI_Mm01_00169816 predicted 1231
5 SASI_Mm01_00169817 predicted 1153
6 SASI_Mm01_00169818 predicted 1018
7 SASI_Mm01_00169819 predicted 463
8 SASI_Mm01_00169820 predicted 895
9 SASI_Mm01_00169821 predicted 877
10 SASI_Mm01_00169822 predicted 524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001031672
CYB5RL MISSION shRNA Bacterial Glycerol Stock
cytochrome b5 reductase-like
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031672.1-363s1c1
Sequence:CCGGCCTGTGTGTTTGACCTCTATCCTCGAGGATAGAGGTCAAACACACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031672.1-678s1c1
Sequence:CCGGGAAGGATACTTTGAAGTGTTACTCGAGTAACACTTCAAAGTATCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031672.1-364s1c1
Sequence:CCGGCTGTGTGTTTGACCTCTATCACTCGAGTGATAGAGGTCAAACACACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031672.1-674s1c1
Sequence:CCGGCGCAGAAGGATACTTTGAAGTCTCGAGACTTCAAAGTATCCTTCTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031672.1-368s1c1
Sequence:CCGGGTGTTTGACCTCTATCACCGACTCGAGTCGGTGATAGAGGTCAAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031672.1-669s1c1
Sequence:CCGGGCCAACGCAGAAGGATACTTTCTCGAGAAAGTATCCTTCTGCGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031672.2-2003s21c1
Sequence:GTACCGGTGGTTGCTATGGAGATCTAAACTCGAGTTTAGATCTCCATAGCAACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031672.2-1238s21c1
Sequence:CCGGCCTCACTGAGGACTCCTATTTCTCGAGAAATAGGAGTCCTCAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031672.2-1120s21c1
Sequence:CCGGACCTGGGCCAGGACCTAATTACTCGAGTAATTAGGTCCTGGCCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031672.2-732s21c1
Sequence:CCGGGGATACTTTGAAGTGTTAATTCTCGAGAATTAACACTTCAAAGTATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031672.2-821s21c1
Sequence:CCGGGCGAGGACCTTTCGGAGATTTCTCGAGAAATCTCCGAAAGGTCCTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001031672
CYB5RL MISSION shRNA shRNA Plasmid DNA
cytochrome b5 reductase-like
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031672.1-363s1c1
Sequence:CCGGCCTGTGTGTTTGACCTCTATCCTCGAGGATAGAGGTCAAACACACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031672.1-678s1c1
Sequence:CCGGGAAGGATACTTTGAAGTGTTACTCGAGTAACACTTCAAAGTATCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031672.1-364s1c1
Sequence:CCGGCTGTGTGTTTGACCTCTATCACTCGAGTGATAGAGGTCAAACACACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031672.1-674s1c1
Sequence:CCGGCGCAGAAGGATACTTTGAAGTCTCGAGACTTCAAAGTATCCTTCTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031672.1-368s1c1
Sequence:CCGGGTGTTTGACCTCTATCACCGACTCGAGTCGGTGATAGAGGTCAAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031672.1-669s1c1
Sequence:CCGGGCCAACGCAGAAGGATACTTTCTCGAGAAAGTATCCTTCTGCGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031672.2-2003s21c1
Sequence:GTACCGGTGGTTGCTATGGAGATCTAAACTCGAGTTTAGATCTCCATAGCAACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031672.2-1238s21c1
Sequence:CCGGCCTCACTGAGGACTCCTATTTCTCGAGAAATAGGAGTCCTCAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031672.2-1120s21c1
Sequence:CCGGACCTGGGCCAGGACCTAATTACTCGAGTAATTAGGTCCTGGCCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031672.2-732s21c1
Sequence:CCGGGGATACTTTGAAGTGTTAATTCTCGAGAATTAACACTTCAAAGTATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031672.2-821s21c1
Sequence:CCGGGCGAGGACCTTTCGGAGATTTCTCGAGAAATCTCCGAAAGGTCCTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001031672
CYB5RL MISSION shRNA Lentiviral Transduction Particles
cytochrome b5 reductase-like
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031672.1-363s1c1
Sequence:CCGGCCTGTGTGTTTGACCTCTATCCTCGAGGATAGAGGTCAAACACACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158927    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031672.1-678s1c1
Sequence:CCGGGAAGGATACTTTGAAGTGTTACTCGAGTAACACTTCAAAGTATCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162236    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031672.1-364s1c1
Sequence:CCGGCTGTGTGTTTGACCTCTATCACTCGAGTGATAGAGGTCAAACACACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162552    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031672.1-674s1c1
Sequence:CCGGCGCAGAAGGATACTTTGAAGTCTCGAGACTTCAAAGTATCCTTCTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031672.1-368s1c1
Sequence:CCGGGTGTTTGACCTCTATCACCGACTCGAGTCGGTGATAGAGGTCAAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163727    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001031672.1-669s1c1
Sequence:CCGGGCCAACGCAGAAGGATACTTTCTCGAGAAAGTATCCTTCTGCGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001031672.2-2003s21c1
Sequence:GTACCGGTGGTTGCTATGGAGATCTAAACTCGAGTTTAGATCTCCATAGCAACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031672.2-1238s21c1
Sequence:CCGGCCTCACTGAGGACTCCTATTTCTCGAGAAATAGGAGTCCTCAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031672.2-1120s21c1
Sequence:CCGGACCTGGGCCAGGACCTAATTACTCGAGTAATTAGGTCCTGGCCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031672.2-732s21c1
Sequence:CCGGGGATACTTTGAAGTGTTAATTCTCGAGAATTAACACTTCAAAGTATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001031672.2-821s21c1
Sequence:CCGGGCGAGGACCTTTCGGAGATTTCTCGAGAAATCTCCGAAAGGTCCTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175471
VALIDATED
CYB5RL MISSION shRNA Bacterial Glycerol Stock
cytochrome b5 reductase-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175471.2-1237s1c1
Sequence:CCGGGCAAATGTCATCACCATGGAACTCGAGTTCCATGGTGATGACATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175471.2-956s1c1
Sequence:CCGGCTACCGTGACAAGACCCATTTCTCGAGAAATGGGTCTTGTCACGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175471.2-1022s1c1
Sequence:CCGGCCGGAGAAAGCCGTTTACCTTCTCGAGAAGGTAAACGGCTTTCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175471.2-588s1c1
Sequence:CCGGGCAGAAGGATACTTTGACGTTCTCGAGAACGTCAAAGTATCCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175471.2-453s1c1
Sequence:CCGGGACACCTATCTTGTCCGGTTTCTCGAGAAACCGGACAAGATAGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175471.2-956s21c1
Sequence:CCGGCTACCGTGACAAGACCCATTTCTCGAGAAATGGGTCTTGTCACGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175471.2-1022s21c1
Sequence:CCGGCCGGAGAAAGCCGTTTACCTTCTCGAGAAGGTAAACGGCTTTCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175471.2-588s21c1
Sequence:CCGGGCAGAAGGATACTTTGACGTTCTCGAGAACGTCAAAGTATCCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175471.2-453s21c1
Sequence:CCGGGACACCTATCTTGTCCGGTTTCTCGAGAAACCGGACAAGATAGGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175471.2-1237s21c1
Sequence:CCGGGCAAATGTCATCACCATGGAACTCGAGTTCCATGGTGATGACATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175471
VALIDATED
CYB5RL MISSION shRNA shRNA Plasmid DNA
cytochrome b5 reductase-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175471.2-1237s1c1
Sequence:CCGGGCAAATGTCATCACCATGGAACTCGAGTTCCATGGTGATGACATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175471.2-956s1c1
Sequence:CCGGCTACCGTGACAAGACCCATTTCTCGAGAAATGGGTCTTGTCACGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175471.2-1022s1c1
Sequence:CCGGCCGGAGAAAGCCGTTTACCTTCTCGAGAAGGTAAACGGCTTTCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175471.2-588s1c1
Sequence:CCGGGCAGAAGGATACTTTGACGTTCTCGAGAACGTCAAAGTATCCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175471.2-453s1c1
Sequence:CCGGGACACCTATCTTGTCCGGTTTCTCGAGAAACCGGACAAGATAGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175471.2-956s21c1
Sequence:CCGGCTACCGTGACAAGACCCATTTCTCGAGAAATGGGTCTTGTCACGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175471.2-1022s21c1
Sequence:CCGGCCGGAGAAAGCCGTTTACCTTCTCGAGAAGGTAAACGGCTTTCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175471.2-588s21c1
Sequence:CCGGGCAGAAGGATACTTTGACGTTCTCGAGAACGTCAAAGTATCCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175471.2-453s21c1
Sequence:CCGGGACACCTATCTTGTCCGGTTTCTCGAGAAACCGGACAAGATAGGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175471.2-1237s21c1
Sequence:CCGGGCAAATGTCATCACCATGGAACTCGAGTTCCATGGTGATGACATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175471
VALIDATED
CYB5RL MISSION shRNA Lentiviral Transduction Particles
cytochrome b5 reductase-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099060    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175471.2-1237s1c1
Sequence:CCGGGCAAATGTCATCACCATGGAACTCGAGTTCCATGGTGATGACATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175471.2-956s1c1
Sequence:CCGGCTACCGTGACAAGACCCATTTCTCGAGAAATGGGTCTTGTCACGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175471.2-1022s1c1
Sequence:CCGGCCGGAGAAAGCCGTTTACCTTCTCGAGAAGGTAAACGGCTTTCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175471.2-588s1c1
Sequence:CCGGGCAGAAGGATACTTTGACGTTCTCGAGAACGTCAAAGTATCCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175471.2-453s1c1
Sequence:CCGGGACACCTATCTTGTCCGGTTTCTCGAGAAACCGGACAAGATAGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175471.2-956s21c1
Sequence:CCGGCTACCGTGACAAGACCCATTTCTCGAGAAATGGGTCTTGTCACGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175471.2-1022s21c1
Sequence:CCGGCCGGAGAAAGCCGTTTACCTTCTCGAGAAGGTAAACGGCTTTCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175471.2-588s21c1
Sequence:CCGGGCAGAAGGATACTTTGACGTTCTCGAGAACGTCAAAGTATCCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175471.2-453s21c1
Sequence:CCGGGACACCTATCTTGTCCGGTTTCTCGAGAAACCGGACAAGATAGGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175471.2-1237s21c1
Sequence:CCGGGCAAATGTCATCACCATGGAACTCGAGTTCCATGGTGATGACATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)